asnS:Gene: Difference between revisions
Edited by wikibot |
Edited by wikibot |
||
| Line 90: | Line 90: | ||
{{GBrowseLink|ecoli_W3110|AC_000091|987007|990407|GBrowse(W3110)}} | {{GBrowseLink|ecoli_W3110|AC_000091|987007|990407|GBrowse(W3110)}} | ||
| | | | ||
{{GBrowseFastaLink|ecoli_W3110|AC_000091|988007|989407|FASTA Dump}} | |||
|-class='sortbottom' | |-class='sortbottom' | ||
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.12419.T46a9bbe7bcf20&page=12419&pagename={{FULLPAGENAMEE}} edit table] || || || || | |[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.12419.T46a9bbe7bcf20&page=12419&pagename={{FULLPAGENAMEE}} edit table] || || || || | ||
Revision as of 04:16, 18 November 2008
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
| Standard name |
asnS |
|---|---|
| Mnemonic | |
| Synonyms |
ECK0921, b0930, JW0913, lcs, tss[1] |
| edit table | |
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
21.27 minutes |
MG1655: 988208..986808 |
||
|
W3110 |
|
W3110: 989407..988007 |
||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
asnS40(ts) |
temperature sensitive |
| |||||
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0913 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGCGTTGTGCCTGTAGCCGA Primer 2:CCGAAGCTGGCGTTACGCGGAGT | |
|
zca-1230::Tn10 |
Linked marker |
est. P1 cotransduction: 18% [4] Synonyms:zbj-1230::Tn10 | |
|
Linked marker |
est. P1 cotransduction: 58% [4] | ||
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 3.0 3.1 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).