bamD:Gene: Difference between revisions
Jmalinverni (talk | contribs) edited by Jmalinverni via TableEdit |
Jmalinverni (talk | contribs) edited by Jmalinverni via TableEdit |
||
| Line 143: | Line 143: | ||
Other | Other | ||
| | | | ||
Results in lower levels of outer- | Partial loss-of-function mutation. Results in lower levels of outer membrane beta-barrel proteins and outer membrane sensitivity. | ||
| | | | ||
<ref name=PMID:16824102/>,<ref name=PMID:17404237/> | <ref name=PMID:16824102/>,<ref name=PMID:17404237/> | ||
| Line 160: | Line 160: | ||
Other | Other | ||
| | | | ||
Results in lower levels of outer- | Partial loss-of-function mutation. Results in lower levels of outer membrane beta-barrel proteins and outer membrane sensitivity. | ||
| | | | ||
<ref name=PMID:16824102/>,<ref name=PMID:17404237/> | <ref name=PMID:16824102/>,<ref name=PMID:17404237/> | ||
Revision as of 17:29, 30 September 2007
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
| Standard name |
yfiO |
|---|---|
| Mnemonic | |
| Synonyms |
ECK2593, b2595, JW2577, ecfD[1] |
| edit table | |
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
58.93 minutes |
MG1655: 2734168..2734905 |
||
|
W3110 |
|
W3110: 2734802..2735539 |
||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
yfiO4 |
C-terminal truncation of 57 nucleotides |
C-terminal truncation of 19 amino acids (-MNAQAEKVAKIIAANSSNT), followed by non-native 10 amino acid tail resulting from drug cassette insertion (+ICLLYTSQPV). |
Other |
Partial loss-of-function mutation. Results in lower levels of outer membrane beta-barrel proteins and outer membrane sensitivity. |
Protein encoded by yfiO4 destabilizes BamCDE sub-complex [2], and results in unstable protein at 37 degrees during stationary phase [3] | ||
|
yfiO5 |
C-terminal truncation of 54 nucleotides |
C-terminal truncation of 18 amino acids (-NAQAEKVAKIIAANSSNT), followed by non-native 1 amino acid tail resulting from drug cassette insertion (+V) |
Other |
Partial loss-of-function mutation. Results in lower levels of outer membrane beta-barrel proteins and outer membrane sensitivity. |
Protein encoded by yfiO5 destabilizes BamCDE sub-complex [2], and results in unstable protein at 37 degrees during stationary phase [3]. yfiO5 outer membrane sensitivity more severe than yfiO4. | ||
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2577 |
Plasmid clone |
Status:Clone OK Primer 1:GCCACGCGCATGAAATATCTGGT Primer 2:CCTGTATTGCTGCTGTTTGCGGC | |
|
Linked marker |
est. P1 cotransduction: 40% [6] | ||
|
Linked marker |
est. P1 cotransduction: 90% [6] | ||
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 2.2 2.3 Malinverni, JC et al. (2006) YfiO stabilizes the YaeT complex and is essential for outer membrane protein assembly in Escherichia coli. Mol. Microbiol. 61 151-64 PubMed
- ↑ 3.0 3.1 3.2 3.3 Sklar, JG et al. (2007) Lipoprotein SmpA is a component of the YaeT complex that assembles outer membrane proteins in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 104 6400-5 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 5.0 5.1 CGSC: The Coli Genetics Stock Center
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).