yaaW:Gene: Difference between revisions
Insert SeqFeature_Table link. |
Adding section & Genetic interactions table to Gene pages. |
||
| Line 16: | Line 16: | ||
|{{Sub}}[[#Sequence Features|Sequence Features]] | |{{Sub}}[[#Sequence Features|Sequence Features]] | ||
|{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]] | |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]] | ||
|{{Sub}}[[#Genetic Interactions | Genetic Interactions]] | |||
|{{Sub}}[[#Genetic Resources |Genetic Resources]] | |{{Sub}}[[#Genetic Resources |Genetic Resources]] | ||
|{{Sub}}[[#Accessions in Other Databases |Accessions]] | |{{Sub}}[[#Accessions in Other Databases |Accessions]] | ||
| Line 186: | Line 187: | ||
===Notes=== | ===Notes=== | ||
==Genetic Interactions== | |||
{{BacktoTop}} | |||
<protect><!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.10599.Q4e04c5bf306dd--> | |||
<!-- | |||
****************************************************************************************** | |||
* | |||
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** | |||
* | |||
****************************************************************************************** -->{{Genetic_interaction_help}} | |||
{| id="Q4e04c5bf306dd" class=" tableEdit Genetic_interaction_table dataTable" | |||
|- {{table_heading_style}} | |||
!|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes | |||
|- class="tableEdit_footer" | |||
|<span class="tableEdit_editLink plainlinks">[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=bc145ea147f7e36caf09c1bfeed4ee9d.10599.Q4e04c5bf306dd&page=10599&pagename={{FULLPAGENAMEE}}&type=0&template=Genetic_interaction_table edit table]</span> || || || || || || | |||
|} | |||
<!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.10599.Q4e04c5bf306dd--></protect> | |||
<!-- Genetic Interacdtions Notes --> | |||
===Notes=== | |||
==Genetic Resources== | ==Genetic Resources== | ||
Revision as of 17:13, 24 June 2011
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
yaaW |
|---|---|
| Mnemonic | |
| Synonyms |
ECK0011, b0011, JW0010, htpY[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
0.23 minutes |
MG1655: 11356..10643 |
||
|
W3110 |
|
W3110: 11356..10643 |
||
|
DH10B: 11356..10643 |
||||
|
NC_012759: 10643..11356 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔyaaW (Keio:JW0010) |
deletion |
deletion |
| ||||
| edit table |
Notes
Genetic Interactions
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW0010 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAATGTTAATTACCTGAATGA Primer 2:CCGACCTGAGTGGCGCTAACCAT | |
|
Linked marker |
est. P1 cotransduction: 69% [5] | ||
|
Linked marker |
est. P1 cotransduction: 45% [5] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 4.0 4.1 CGSC: The Coli Genetics Stock Center
- ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).