ydjO:Gene: Difference between revisions
/Volumes/r3/t3/ul/working/touchTables/touch_all_tables.php |
Convert to gbrowse_img.php extension. |
||
| Line 75: | Line 75: | ||
39.02 minutes, 39.02 minutes | 39.02 minutes, 39.02 minutes | ||
| | | | ||
MG1655: 1811168..1810353<br /> | MG1655: 1811168..1810353<br /><gbrowseImage> | ||
name=NC_000913:1810353..1811168 | |||
source=ecoli | |||
preset=GeneLocation | |||
</gbrowseImage> | |||
| | | | ||
*[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=G6935 EcoCyc] | *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=G6935 EcoCyc] | ||
| Line 89: | Line 94: | ||
| | | | ||
NC_012967: 1790409..1789615<br /> | NC_012967: 1790409..1789615<br /><gbrowseImage> | ||
name=NC_012967:1789615..1790409 | |||
source=REL606 | |||
preset=GeneLocation | |||
</gbrowseImage> | |||
| | | | ||
{{GBrowseLink|REL606|NC_012967|1789615|1790409|GBrowse (REL606)}} | {{GBrowseLink|REL606|NC_012967|1789615|1790409|GBrowse (REL606)}} | ||
| Line 100: | Line 110: | ||
| | | | ||
NC_012759: 1702412..1703227<br /> | NC_012759: 1702412..1703227<br /><gbrowseImage> | ||
name=NC_012759:1702412..1703227 | |||
source=BW2952 | |||
preset=GeneLocation | |||
</gbrowseImage> | |||
| | | | ||
{{GBrowseLink|BW2952|012759|1702412|NC_1703227|GBrowse (BW2952)}} | {{GBrowseLink|BW2952|012759|1702412|NC_1703227|GBrowse (BW2952)}} | ||
| Line 111: | Line 126: | ||
| | ||
| | | | ||
W3110: 1814858..1814043<br /> | W3110: 1814858..1814043<br /><gbrowseImage> | ||
name=AC_000091:1814043..1814858 | |||
source=ecoli_W3110 | |||
preset=GeneLocation | |||
</gbrowseImage> | |||
| | | | ||
{{GBrowseLink|ecoli_W3110|AC_000091|1813043|1815858|GBrowse(W3110)}} | {{GBrowseLink|ecoli_W3110|AC_000091|1813043|1815858|GBrowse(W3110)}} | ||
| Line 122: | Line 142: | ||
| | | | ||
DH10B: 1901739..1900924<br /> | DH10B: 1901739..1900924<br /><gbrowseImage> | ||
name=NC_010473:1900924..1901739 | |||
source=ecoli_DH10B | |||
preset=GeneLocation | |||
</gbrowseImage> | |||
| | | | ||
{{GBrowseLink|ecoli_DH10B|NC_010473|1899294|1903369|GBrowse(DH10B)}} | {{GBrowseLink|ecoli_DH10B|NC_010473|1899294|1903369|GBrowse(DH10B)}} | ||
Revision as of 22:35, 26 July 2010
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ydjO |
|---|---|
| Mnemonic |
Systematic nomenclature |
| Synonyms |
ECK1728, b1730, JW1719[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
39.02 minutes, 39.02 minutes |
MG1655: 1811168..1810353 |
||
|
NC_012967: 1790409..1789615 |
||||
|
NC_012759: 1702412..1703227 |
||||
|
W3110 |
|
W3110: 1814858..1814043 |
||
|
DH10B: 1901739..1900924 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔydjO (Keio:JW1719) |
deletion |
deletion |
|||||
|
ΔydjO729::kan |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1719 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGGCGGGAGATGTTTTCTAC Primer 2:CCTGCTGGCAACGGTCCGTTTTG | |
|
zdi-925::Tn10 |
Linked marker |
est. P1 cotransduction: 26% [5] | |
|
Linked marker |
est. P1 cotransduction: 44% [5] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 5.0 5.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).