yhaM:Gene: Difference between revisions
Fixing zoom on GBrowse image. |
Data loaded by TableEdit_Loader. |
||
| Line 104: | Line 104: | ||
| | | | ||
{{GBrowseFastaLink|ecoli_DH10B|NC_010473|3348488|3355038|FASTA Dump}} | {{GBrowseFastaLink|ecoli_DH10B|NC_010473|3348488|3355038|FASTA Dump}} | ||
|- | |||
| | |||
[[REL606]] | |||
| | |||
| | |||
NC_012967: 3188374..3189684<br />{{GBrowseFigureByCoord|3188374|3189684|REL606|NC_012967}} | |||
| | |||
{{GBrowseLink|REL606|NC_012967|3188374|3189684|GBrowse (REL606)}} | |||
| | |||
{{GBrowseFastaLink|REL606|NC_012967|3188374|3189684|FASTA Dump}} | |||
|-class='sortbottom' | |-class='sortbottom' | ||
Revision as of 17:11, 14 December 2009
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
yhaM |
|---|---|
| Mnemonic | |
| Synonyms |
ECK3099, b4470, JW5518, yhaN, b3109 (obsolete), b3108 (obsolete)[1][2] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
70.12 minutes |
MG1655: 3254673..3253363 |
||
|
W3110 |
|
W3110: 3255307..3253997 |
||
|
DH10B: 3352418..3351108 |
||||
|
NC_012967: 3188374..3189684 |
||||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔyhaM (Keio:JW5518) |
deletion |
deletion |
|||||
|
ΔyhaM727::kan |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW5518 |
Plasmid clone |
Status:Clone OK Primer 1:GCCTTTGATTCGACTTTAAATCC Primer 2:CCTCTGGCCTTGCTCGCCATAAT | |
|
Linked marker |
est. P1 cotransduction: 21% [6] | ||
|
Linked marker |
est. P1 cotransduction: % [6] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ EcoCyc (release 10.6; 2007) Keseler, IM et al. (2005) Nucleic Acids Res. 33(Database issue):D334-7
- ↑ 3.0 3.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 4.0 4.1 4.2 CGSC: The Coli Genetics Stock Center
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).