ubiD:Gene: Difference between revisions
imported>Wikientrybot Move help links into the <above> tag inside templates. |
imported>Wikientrybot No edit summary |
||
| Line 198: | Line 198: | ||
CAG18491 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40350 CGSC7464]<ref name='LIB:cgsc'/> | CAG18491 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40350 CGSC7464]<ref name='LIB:cgsc'/> | ||
| | | | ||
est. P1 cotransduction: 60% <ref name='LIB:Nichols_linked_Tn'/> | est. P1 cotransduction: 60% <ref name='LIB:Nichols_linked_Tn'/> <br /> | ||
Synonyms:metE3079::Tn10 nnnThe Tn10 in CAG13491 is inserted in the metE regulatory region, but causes a Met- phenotype. | |||
|- | |- | ||
| | | | ||
| Line 207: | Line 208: | ||
CAG18496 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40344 CGSC7465]<ref name='LIB:cgsc'/> | CAG18496 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40344 CGSC7465]<ref name='LIB:cgsc'/> | ||
| | | | ||
est. P1 cotransduction: 87% <ref name='LIB:Nichols_linked_Tn'/> | est. P1 cotransduction: 87% <ref name='LIB:Nichols_linked_Tn'/> <br /> | ||
Synonyms:fadAB101::Tn10 | |||
|-class='sortbottom' | |-class='sortbottom' | ||
Revision as of 18:55, 29 January 2009
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ubiD |
|---|---|
| Mnemonic | |
| Synonyms |
ECK3835, b3843, JW3819, yigC, yigY[1] |
| edit table |
Notes
Location(s) and DNA Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
86.71 minutes |
MG1655: 4023011..4024504 |
||
|
W3110 |
|
W3110: 3611693..3610200 |
||
| edit table |
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature type | Location | Description |
|---|---|---|
| edit table |
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ubiD410 |
| ||||||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW3819 |
Plasmid clone |
PMID:16769691[2]
Status:Clone OK Primer 1:GCCGACGCCATGAAATATAACGA Primer 2:CCGGCGCTTTTACCGTTGTTAAA | |
|
metEo-3079::Tn10 |
Linked marker |
est. P1 cotransduction: 60% [4] | |
|
Linked marker |
est. P1 cotransduction: 87% [4] | ||
| edit table |
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
References
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 3.0 3.1 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).