cfa:Gene: Difference between revisions
Data loaded by TableEdit_Loader. |
Appended "[[Category..." using batch script. |
||
| Line 445: | Line 445: | ||
[[Category:Genes in the Keio knockout collection]] | [[Category:Genes in the Keio knockout collection]] | ||
[[Category:Genes in the ASKA clone collection]] | [[Category:Genes in the ASKA clone collection]] | ||
[[Category:cfa genes]] | |||
Revision as of 00:19, 25 September 2008
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
| Standard name |
cfa |
|---|---|
| Mnemonic | |
| Synonyms |
ECK1657, b1661, JW1653, cdfA[1] |
| edit table | |
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
37.49 minutes |
MG1655: 1739437..1740585 |
||
|
W3110 |
|
W3110: 1743127..1744275 |
||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
Δcfa (Keio:JW1653) |
deletion |
deletion |
|||||
|
cfa-1 |
|||||||
|
cfa-2 |
|||||||
|
cfa-3 |
|||||||
|
cfa-4 |
|||||||
|
cfa-5::kan |
|||||||
|
cfa-0 |
|||||||
|
Δcfa-739::kan |
| ||||||
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW1653 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAGTTCATCGTGTATAGAAGA Primer 2:CCGCGAGCCACTCGAAGGCCGTT | |
|
Linked marker |
est. P1 cotransduction: % [9] Synonyms:zdc-235::Tn10 | ||
|
zdi-925::Tn10 |
Linked marker |
est. P1 cotransduction: 21% [9] Synonyms:zdh-925::Tn10 | |
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ 4.0 4.1 4.2 Grogan, DW & Cronan, JE Jr (1984) Genetic characterization of the Escherichia coli cyclopropane fatty acid (cfa) locus and neighboring loci. Mol. Gen. Genet. 196 367-72 PubMed
- ↑ 5.0 5.1 5.2 Grogan, DW & Cronan, JE Jr (1986) Characterization of Escherichia coli mutants completely defective in synthesis of cyclopropane fatty acids. J. Bacteriol. 166 872-7 PubMed
- ↑ Chang, YY & Cronan, JE Jr (1999) Membrane cyclopropane fatty acid content is a major factor in acid resistance of Escherichia coli. Mol. Microbiol. 33 249-59 PubMed
- ↑ Fellay, R et al. (1987) Interposon mutagenesis of soil and water bacteria: a family of DNA fragments designed for in vitro insertional mutagenesis of gram-negative bacteria. Gene 52 147-54 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).