fruA:Gene: Difference between revisions
Data loaded by TableEdit_Loader. |
Data loaded by TableEdit_Loader. |
||
| Line 342: | Line 342: | ||
<!-- | <!-- | ||
****************************************************************************************** | ****************************************************************************************** | ||
* | * | ||
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** | * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** | ||
* | * | ||
****************************************************************************************** --> | ****************************************************************************************** --> | ||
{|class = 'sortable' | {|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" | ||
|- {{table_heading_style}} | |- {{table_heading_style}} | ||
!Database!!Accession!!Notes | !|Database!!Accession!!Notes | ||
|- | |- | ||
| | | | ||
[http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]]) | [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]]) | ||
| | | | ||
[http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&object=EG10336 EcoCyc:EG10336] | [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&object=EG10336 EcoCyc:EG10336] | ||
| | | | ||
|- | |- | ||
| | | | ||
[http://www.ecoli-york.org EchoBASE] ([[EchoBASE|EcoliWiki Page]]) | [http://www.ecoli-york.org EchoBASE] ([[EchoBASE|EcoliWiki Page]]) | ||
| | | | ||
[http://www.york.ac.uk/res/thomas/Gene.cfm?recordID=EB0332 EchoBASE:EB0332] | [http://www.york.ac.uk/res/thomas/Gene.cfm?recordID=EB0332 EchoBASE:EB0332] | ||
| | | | ||
|- | |- | ||
| | | | ||
[http://chase.ou.edu/oubcf/index.php EcoliGenExpDB] ([[EcoliGenExpDB|EcoliWiki Page]]) | [http://chase.ou.edu/oubcf/index.php EcoliGenExpDB] ([[EcoliGenExpDB|EcoliWiki Page]]) | ||
| | | | ||
[http://chase.ou.edu/macro/searchlink.php?bnum=b2167 EcoliGenExpDB:b2167] | [http://chase.ou.edu/macro/searchlink.php?bnum=b2167 EcoliGenExpDB:b2167] | ||
| | | | ||
|- | |- | ||
| | | | ||
[http://BioCyc.org/ECOL199310/ ECOL199310CYC] ([[ECOL199310CYC|EcoliWiki Page]]) | [http://BioCyc.org/ECOL199310/ ECOL199310CYC] ([[ECOL199310CYC|EcoliWiki Page]]) | ||
| | | | ||
[http://BioCyc.org/ECOL199310/new-image?object=C2702 ECOL199310CYC:C2702] | [http://BioCyc.org/ECOL199310/new-image?object=C2702 ECOL199310CYC:C2702] | ||
| | | | ||
|- | |- | ||
| | | | ||
[http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]]) | [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]]) | ||
| | | | ||
[http://ecogene.org/geneinfo.php?eg_id=EG10336 EcoGene:EG10336] | [http://ecogene.org/geneinfo.php?eg_id=EG10336 EcoGene:EG10336] | ||
| | | | ||
|- | |- | ||
| | | | ||
[http://BioCyc.org/ECOO157/ ECOO157CYC] ([[ECOO157CYC|EcoliWiki Page]]) | [http://BioCyc.org/ECOO157/ ECOO157CYC] ([[ECOO157CYC|EcoliWiki Page]]) | ||
| | | | ||
[http://BioCyc.org/ECOO157/new-image?object=FRUA ECOO157CYC:FRUA] | [http://BioCyc.org/ECOO157/new-image?object=FRUA ECOO157CYC:FRUA] | ||
| | | | ||
|- | |- | ||
| | | | ||
[http://cgsc.biology.yale.edu CGSC] ([[CGSC|EcoliWiki Page]]) | [http://cgsc.biology.yale.edu CGSC] ([[CGSC|EcoliWiki Page]]) | ||
| | | | ||
[http://cgsc.biology.yale.edu/cgi-bin/sybgw/cgsc/Site/350 CGSC:350] | [http://cgsc.biology.yale.edu/cgi-bin/sybgw/cgsc/Site/350 CGSC:350] | ||
| | | | ||
|- | |||
| | |||
[https://asap.ahabs.wisc.edu/asap/logon.php ASAP] ([[ASAP|EcoliWikiPage]]) | |||
| | |||
[http://asap.ahabs.wisc.edu/asap/feature_info.php?LocationID=WIS&FeatureID=0007172&formSubmitReturn=1 ASAP:ABE-0007172] | |||
| | |||
|-class='sortbottom' | |-class='sortbottom' | ||
|[{{SERVER}}{{SCRIPTPATH}} | |[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.14895.G46a9d79a0efe4&page=14895&pagename={{FULLPAGENAMEE}}&type=0&template=Gene_accessions_table edit table] || || | ||
|} | |} | ||
<!--box uid=421aa90e079fa326b6494f812ad13e79.14895.G46a9d79a0efe4--> | <!--box uid=421aa90e079fa326b6494f812ad13e79.14895.G46a9d79a0efe4--> | ||
Revision as of 23:47, 15 September 2008
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
| Standard name |
fruA |
|---|---|
| Mnemonic | |
| Synonyms |
ECK2160, b2167, JW2154, ptsF[1] |
| edit table | |
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
48.66 minutes |
MG1655: 2259432..2257741 |
||
|
W3110 |
|
W3110: 2264744..2263053 |
||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔfruA (Keio:JW2154) |
deletion |
deletion |
|||||
|
fruA5 |
|||||||
|
fruA3 |
|||||||
|
fruA10 |
|||||||
|
fruA0 |
|||||||
|
fruA9 |
|||||||
|
fruA4 |
|||||||
|
ΔfruA723::kan |
| ||||||
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
A homologous recombination using various digestive enzymes allowed the mutant allele, fruA2 to be derived.The initial transformant colonies were selected in the presence of both thiostrepton and apramycin. FruA is specifically involved in fructose catabolism. A nonpolar fruA mutation impairs growth on fructose and also leads to a constitutive low expression of the fru operon. Uptake and phosphorylation of frustose to fructose-1-phosphate by fruA is necessary to relieve repression by fruR[4].
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2154 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAAACGCTGCTGATTATTGA Primer 2:CCgGCTGCTTTCGCTACTGCGTC | |
|
Linked marker |
est. P1 cotransduction: % [6] Synonyms:zbc-3105::Tn10, zbd-3105::Tn10 | ||
|
Linked marker |
est. P1 cotransduction: 15% [6] Synonyms:zeg-722, zei-722::Tn10 | ||
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
|
| ||
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ 2.0 2.1 Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ Barrière, C et al. (2005) Fructose utilization in Lactococcus lactis as a model for low-GC gram-positive bacteria: its regulator, signal, and DNA-binding site. J. Bacteriol. 187 3752-61 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).