bamD:Gene: Difference between revisions

From EcoliWiki
Jump to navigation Jump to search
← Older editNewer edit →
Edited by wikibot
Line 45: Line 45:
''ECK2593, b2595, JW2577, ecfD, bamD''<ref name='LIB:Riley_2006'/><ref name='LIB:EcoGene'/>
''ECK2593, b2595, JW2577, ecfD, bamD''<ref name='LIB:Riley_2006'/><ref name='LIB:EcoGene'/>
|-
|-
|colspan='2'|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15761.A46a9e1c943609&page=15761&pagename={{FULLPAGENAMEE}} edit table]
|colspan='2'|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15761.A46a9e1c943609&page=15761&pagename={{FULLPAGENAMEE}} edit table]
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.15761.A46a9e1c943609-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.15761.A46a9e1c943609-->
Line 94: Line 94:
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli_W3110/?plugin=FastaDumper&name=W3110:2734802..2735539&plugin_action=Go FASTA Dump]  
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli_W3110/?plugin=FastaDumper&name=W3110:2734802..2735539&plugin_action=Go FASTA Dump]  
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15761.W46a9e1c9c1929&page=15761&pagename={{FULLPAGENAMEE}} edit table] || || || ||
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15761.W46a9e1c9c1929&page=15761&pagename={{FULLPAGENAMEE}} edit table] || || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.15761.W46a9e1c9c1929-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.15761.W46a9e1c9c1929-->
Line 115: Line 115:
!Feature type!!Location!!Description
!Feature type!!Location!!Description
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15761.J46a9e1ca7b2f3&page=15761&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15761.J46a9e1ca7b2f3&page=15761&pagename={{FULLPAGENAMEE}} edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.15761.J46a9e1ca7b2f3-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.15761.J46a9e1ca7b2f3-->
Line 170: Line 170:
Protein encoded by yfiO5 destabilizes BamCDE sub-complex <ref name=PMID:16824102/>, and results in unstable protein at 37 degrees during stationary phase <ref name=PMID:17404237/>.  yfiO5 outer membrane sensitivity more severe than yfiO4.  
Protein encoded by yfiO5 destabilizes BamCDE sub-complex <ref name=PMID:16824102/>, and results in unstable protein at 37 degrees during stationary phase <ref name=PMID:17404237/>.  yfiO5 outer membrane sensitivity more severe than yfiO4.  
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15761.R46a9e1cac141c&page=15761&pagename={{FULLPAGENAMEE}} edit table] || || || || || || ||
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15761.R46a9e1cac141c&page=15761&pagename={{FULLPAGENAMEE}} edit table] || || || || || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.15761.R46a9e1cac141c-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.15761.R46a9e1cac141c-->
Line 224: Line 224:
est. P1 cotransduction: 90% <ref name='LIB:Nichols_linked_Tn'/>  
est. P1 cotransduction: 90% <ref name='LIB:Nichols_linked_Tn'/>  
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15761.O46a9e1cb7b166&page=15761&pagename={{FULLPAGENAMEE}} edit table] || || ||
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15761.O46a9e1cb7b166&page=15761&pagename={{FULLPAGENAMEE}} edit table] || || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.15761.O46a9e1cb7b166-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.15761.O46a9e1cb7b166-->
Line 287: Line 287:
   
   
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15761.O46a9e1cc1d695&page=15761&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15761.O46a9e1cc1d695&page=15761&pagename={{FULLPAGENAMEE}} edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.15761.O46a9e1cc1d695-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.15761.O46a9e1cc1d695-->
Line 308: Line 308:
!Name!!URL!!Comments
!Name!!URL!!Comments
|-class='sortbottom'
|-class='sortbottom'
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15761.E46a6fe7807f08&page=15761&pagename={{FULLPAGENAMEE}} edit table] || ||
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.15761.E46a6fe7807f08&page=15761&pagename={{FULLPAGENAMEE}} edit table] || ||
|}
|}
<!--box uid=421aa90e079fa326b6494f812ad13e79.15761.E46a6fe7807f08-->
<!--box uid=421aa90e079fa326b6494f812ad13e79.15761.E46a6fe7807f08-->

Revision as of 08:32, 30 April 2008

{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>

Quickview   Gene   Gene Product(s)   Expression   Evolution   On One Page    
Nomenclature Location(s) and DNA Sequence Alleles and Phenotypes Genetic Resources Accessions Links References Suggestions

Nomenclature

[back to top]


Standard name

yfiO

Mnemonic
Synonyms

ECK2593, b2595, JW2577, ecfD, bamD[1][2]

edit table

See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.

Notes

A consensus has been reached for renaming the genes that encode components of the outer membrane β-barrel assembly machine, (formerly known as the YaeT complex of E. coli or the Omp85 complex of N. meningitidis). The new designation for this multi-component structure is the Bam complex (for beta-barrel assembly machine).

The Bam complex in E. coli consists of BamA (YaeT), BamB (YfgL), BamC (NlpB), BamD (YfiO), and BamE (SmpA). Letters have been assigned on the basis of molecular weight, from highest to lowest [2].

Location(s) and DNA Sequence

[back to top]


Strain Map location Genome coordinates Genome browsers Sequence links

MG1655

58.93 minutes 

MG1655: 2734168..2734905
gbrowse_img.php?coord=2733168..2735905&genome=ecoli&name=MG1655&trackset=0&width=300&.png

W3110

 

W3110: 2734802..2735539
gbrowse_img.php?coord=2733802..2736539&genome=ecoli_W3110&name=W3110&trackset=0&width=300&.png

edit table

See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.

Notes

Sequence Features

[back to top]


Feature type Location Description
edit table

See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.

Notes

Alleles and Phenotypes

[back to top]


Allele Nt change(s) AA change(s) Phenotype: Type Phenotype: Description Reference Availability Comments

yfiO4

C-terminal truncation of 57 nucleotides

C-terminal truncation of 19 amino acids (-MNAQAEKVAKIIAANSSNT), followed by non-native 10 amino acid tail resulting from drug cassette insertion (+ICLLYTSQPV).

Other

Partial loss-of-function mutation. Results in lower levels of outer membrane beta-barrel proteins and outer membrane sensitivity.

[3],[4]

Protein encoded by yfiO4 destabilizes BamCDE sub-complex [3], and results in unstable protein at 37 degrees during stationary phase [4]

yfiO5

C-terminal truncation of 54 nucleotides

C-terminal truncation of 18 amino acids (-NAQAEKVAKIIAANSSNT), followed by non-native 1 amino acid tail resulting from drug cassette insertion (+V)

Other

Partial loss-of-function mutation. Results in lower levels of outer membrane beta-barrel proteins and outer membrane sensitivity.

[3],[4]

Protein encoded by yfiO5 destabilizes BamCDE sub-complex [3], and results in unstable protein at 37 degrees during stationary phase [4]. yfiO5 outer membrane sensitivity more severe than yfiO4.

edit table

See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.

Notes

Genetic Resources

[back to top]


Resource Resource Type Source Notes/Reference

JW2577

Plasmid clone

Shigen

PMID:16769691[5]

Status:Clone OK

Primer 1:GCCACGCGCATGAAATATCTGGT

Primer 2:CCTGTATTGCTGCTGTTTGCGGC

nadB51::Tn10

Linked marker

CAG18480 = CGSC7419[6]

est. P1 cotransduction: 40% [7]

pheA18::Tn10

Linked marker

CAG12158 = CGSC7421[6]

est. P1 cotransduction: 90% [7]

edit table

See Help:Gene_resources for help entering information into the Genetic Resources table.

Notes

Accessions in Other Databases

[back to top]


Database Accession Notes

EcoCyc (EcoliWiki Page)

EcoCyc:G7352

EchoBASE (EcoliWiki Page)

EchoBASE:EB3974

EcoliGenExpDB (EcoliWiki Page)

EcoliGenExpDB:b2595

ECOL199310CYC (EcoliWiki Page)

ECOL199310CYC:C3117

EcoGene (EcoliWiki Page)

EcoGene:EG14222

ECOO157CYC (EcoliWiki Page)

ECOO157CYC:Z3889

edit table

See Help:Gene_accessions for help with entering information into the Gene Accessions table.

Notes

Links

[back to top]


Name URL Comments
edit table

See Help:Links_table for how to enter or edit information in this section of EcoliWiki.

References

[back to top]


See Help:References for how to manage references in EcoliWiki.

  1. ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
  2. ↑ 2.0 2.1 EcoGene: Rudd, KE (2000) EcoGene: a genome sequence database for Escherichia coli K-12. Nucleic Acids Res 28:60-4.
  3. ↑ 3.0 3.1 3.2 3.3 Malinverni, JC et al. (2006) YfiO stabilizes the YaeT complex and is essential for outer membrane protein assembly in Escherichia coli. Mol. Microbiol. 61 151-64 PubMed
  4. ↑ 4.0 4.1 4.2 4.3 Sklar, JG et al. (2007) Lipoprotein SmpA is a component of the YaeT complex that assembles outer membrane proteins in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 104 6400-5 PubMed
  5. ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
  6. ↑ 6.0 6.1 CGSC: The Coli Genetics Stock Center
  7. ↑ 7.0 7.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).


Categories

Retrieved from "https://ecoliwiki.org/colipedia/index.php?title=bamD:Gene&oldid=392528"