fruA:Gene: Difference between revisions
edited by 127.0.0.1 via TableEdit |
|||
| Line 157: | Line 157: | ||
<protect><!--Alleles_notes--></protect> | <protect><!--Alleles_notes--></protect> | ||
===Notes=== | ===Notes=== | ||
A homologous recombination using various digestive enzymes allowed the mutant allele, fruA2 to be derived.The initial transformant colonies were selected in the presence of both thiostrepton and apramycin. ''Fru''A is specifically involved in fructose catabolism. A nonpolar ''fru''A mutation impairs growth on fructose and also leads to a constitutive low expression of the ''fru'' operon. Uptake and phosphorylation of frustose to fructose-1-phosphate by ''fru''A is necessary to relieve repression by fruR<ref name='PMID:15901699 '/>. | |||
==Genetic Resources== | ==Genetic Resources== | ||
Revision as of 07:58, 8 November 2007
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
| Standard name |
fruA |
|---|---|
| Mnemonic | |
| Synonyms |
ECK2160, b2167, JW2154, ptsF[1] |
| edit table | |
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
48.66 minutes |
MG1655: 2259432..2257741 |
||
|
W3110 |
|
W3110: 2264744..2263053 |
||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ΔfruA (Keio:JW2154) |
deletion |
deletion |
|||||
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
A homologous recombination using various digestive enzymes allowed the mutant allele, fruA2 to be derived.The initial transformant colonies were selected in the presence of both thiostrepton and apramycin. FruA is specifically involved in fructose catabolism. A nonpolar fruA mutation impairs growth on fructose and also leads to a constitutive low expression of the fru operon. Uptake and phosphorylation of frustose to fructose-1-phosphate by fruA is necessary to relieve repression by fruR[4].
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2154 |
Plasmid clone |
Status:Clone OK Primer 1:GCCAAAACGCTGCTGATTATTGA Primer 2:CCgGCTGCTTTCGCTACTGCGTC | |
|
Linked marker |
est. P1 cotransduction: % [6] Synonyms:zbc-3105::Tn10, zbd-3105::Tn10 | ||
|
Linked marker |
est. P1 cotransduction: 15% [6] Synonyms:zeg-722, zei-722::Tn10 | ||
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ 3.0 3.1 3.2 CGSC: The Coli Genetics Stock Center
- ↑ Barrière, C et al. (2005) Fructose utilization in Lactococcus lactis as a model for low-GC gram-positive bacteria: its regulator, signal, and DNA-binding site. J. Bacteriol. 187 3752-61 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 6.0 6.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).