Talk:pRS551

From EcoliWiki
Revision as of 22:11, 28 October 2011 by Gbenison (talk | contribs) (Created page with 'The sequence on this page (which corresponds to the sequence found by following the link) appears incorrect - it contains two EcoRI sites, not one. There is a file containing a ...')
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigation Jump to search

The sequence on this page (which corresponds to the sequence found by following the link) appears incorrect - it contains two EcoRI sites, not one. There is a file containing a "pRS551" sequence floating around my lab which differs from the one on this page by a single nucleotide:

< TATCGGCGCAATTCCAGCTGAGCGCCGGTCGCTACCATTA --- > TATCGGCGGAATTCCAGCTGAGCGCCGGTCGCTACCATTA

This mutation removes the second EcoRI site, which seems consistent with the drawn map, and how the actual plasmid behaves in digests.

Retrieved from "https://ecoliwiki.org/colipedia/index.php?title=Talk:pRS551&oldid=1362319"