Talk:pRS551
The sequence on this page (which corresponds to the sequence found by following the link) appears incorrect - it contains two EcoRI sites, not one. There is a file containing a "pRS551" sequence floating around my lab which differs from the one on this page by a single nucleotide:
< TATCGGCGCAATTCCAGCTGAGCGCCGGTCGCTACCATTA --- > TATCGGCGGAATTCCAGCTGAGCGCCGGTCGCTACCATTA
This mutation removes the second EcoRI site, which seems consistent with the drawn map, and how the actual plasmid behaves in digests.