mlrA:Gene: Difference between revisions
imported>WikiEntryBot Automated import of articles |
edited by 127.0.0.1 via TableEdit |
||
| Line 126: | Line 126: | ||
| | | | ||
[[PMID: | [[PMID:16738554]]<ref name=PMID:16738554/>|[http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen] | ||
| | | | ||
|-class='sortbottom' | |-class='sortbottom' | ||
|[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.14813.B46a9d6a37bce0&page=14813&pagename={{FULLPAGENAMEE}} edit table] || || || || || || | |[{{SERVER}}/colipedia/index.php/Special:TableEdit?id=421aa90e079fa326b6494f812ad13e79.14813.B46a9d6a37bce0&page=14813&pagename={{FULLPAGENAMEE}} edit table] || || || || || || | ||
Revision as of 22:49, 27 July 2007
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Alleles and Phenotypes | Genetic Resources | Accessions | Links | References | Suggestions |
Nomenclature
| Standard name |
mlrA |
|---|---|
| Mnemonic | |
| Synonyms |
ECK2119, b2127, JW2115, yehV[1] |
| edit table | |
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
Notes
Location(s) and DNA Sequence
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
47.69 minutes, 47.69 minutes |
MG1655: 2212888..2213619 |
||
|
W3110 |
|
W3110: 2218200..2218931 |
||
| edit table |
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
Notes
Sequence Features
| Feature type | Location | Description |
|---|---|---|
| edit table |
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
Notes
Alleles and Phenotypes
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability |
|---|---|---|---|---|---|---|
|
ΔmlrA (Keio:JW2115) |
deletion |
deletion |
||||
| edit table |
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
Notes
Genetic Resources
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW2115 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCGCTTTACACAATTGGTGA Primer 2:CCAATGCCGAGTGGGAAAATATC | |
| edit table |
See Help:Gene_resources for help entering information into the Genetic Resources table.
Notes
Accessions in Other Databases
| Database | Accession | Notes |
|---|---|---|
| edit table |
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
See Help:Links_table for how to enter or edit information in this section of EcoliWiki.
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Baba, T et al. (2006) Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol. Syst. Biol. 2 2006.0008 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed