Cis Element:migS
Cis element summary table
| Standard Name |
migS |
|---|---|
| Synonyms | |
| Function |
bipolar positioning of the replicated oriC segment |
| Location |
89.1-89.5 |
| SO terms |
|
| edit table |
Notes
Location and Sequence
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MC1061 |
89.1-89.5 |
| ||
| edit table |
Notes
The sequence is a 25bp imperfect inverted repeat (ATTTTTGCGGGTACTCAGCAAAATT) within the yijF gene located within the Ori domain of the chromosome.
Interactions
See Help:Product_interactions for help entering or editing information about gene product interactions in this section of EcoliWiki.
| Partner Type | Partner | Notes | References | Evidence |
|---|---|---|---|---|
| edit table |
Notes
Mutant alleles and phenotypes
| Allele | Nt change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|
|
migS-g10c |
G10C |
disruption of bipolar migration of the Ori domain of the chromosome |
Index of Bipolar Positioning (IBP)= 10.4 | |||
|
migS-c8g |
C8G |
disruption of bipolar migration of the Ori domain of the chromosome |
Index of Bipolar Positioning (IBP)= 14.1 | |||
|
migS-g7cc8g |
G7C and C8G |
disruption of bipolar migration of the Ori domain of the chromosome |
Index of Bipolar Positioning (IBP)= 22.0 | |||
|
∆migS |
enhances ts lethality of the mukB null mutation |
|||||
|
∆migS |
Sensitivity to |
more sensitive to Zeocin (Invitrogen) |
| |||
| edit table |
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
| edit table |
Notes
Accessions
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
EcoCyc: |
Escherichia coli str. K-12 substr. MG1655 | |
|
EcoGene: |
Escherichia coli str. K-12 substr. MG1655 | |
|
RegulonDB: |
Escherichia coli str. K-12 substr. MG1655 | |
|
EchoBASE: |
Escherichia coli str. K-12 substr. MG1655 | |
|
ASAP: |
Escherichia coli str. K-12 substr. MG1655 | |
| edit table |
Notes
References
See Help:References for how to manage references in EcoliWiki.
- ↑ 1.0 1.1 1.2 1.3 Yamaichi, Y & Niki, H (2004) migS, a cis-acting site that affects bipolar positioning of oriC on the Escherichia coli chromosome. EMBO J. 23 221-33 PubMed
- ↑ Fekete, RA & Chattoraj, DK (2005) A cis-acting sequence involved in chromosome segregation in Escherichia coli. Mol. Microbiol. 55 175-83 PubMed