PMID:15942870
| Citation |
Talukder, AA, Yanai, S and Yamada, M (2005) Analysis of reading frame and expressional regulation of randomly selected promoter-proximal genes in Escherichia coli. J. Gen. Appl. Microbiol. 51:93-103 |
|---|---|
| Abstract |
The expression of seventy-seven randomly cloned genes of Escherichia coli was examined following a variety of treatments including heat shock, glucose starvation, phosphate starvation, ammonium starvation or osmotic shock, with the aid of lacZ reporter gene protein fusions on multicopy plasmids. Two of 77 genes (amr and yigL) had not previously been identified as protein encoding open-reading frames (ORFs) in annotations of the E. coli genome database. Thirteen genes exhibited significant changes in expression in response to at least one of the treatments, and six of them appeared to be controlled by more than one sigma (sigma) factor of RNA polymerase. This study thus allows us not only to identify the reading frame of the genomic genes but also to support the hypothesis earlier proposed that a significant proportion of genes in E. coli are involved in adaptations to various stresses to which the organism is likely to be exposed in the environment. |
| Links | |
| Keywords |
Amino Acid Sequence; Bacterial Proteins/genetics; Base Sequence; Escherichia coli/genetics; Gene Expression Regulation, Bacterial/genetics; Gene Library; Genes, Bacterial/genetics; Molecular Sequence Data; Open Reading Frames/genetics; Promoter Regions, Genetic/genetics; Sequence Analysis, DNA; Sigma Factor/genetics |
| edit table |
Significance
You can help EcoliWiki by summarizing why this paper is useful
Other comments on paper
The gene fused to lacZ in clone pYU70 appears to be misidentified in Table 2. The fusion junction is described as being within yjgL, which has coordinates NC_000913:4473460..4475274, but the sequence shown (TCGAGCCCGCAAGTGAAGAGATATTACCTTGATC) actually matches MG1655 sequences 4534538..4534571, which is within yjhS.
Useful Materials and Methods
You can help Ecoliwiki by describing the useful materials (strains, plasmids, antibodies, etc) described in this paper.
Annotations
<annotationlinks/>
EcoliWiki Links
Add links to pages that link here (e.g. gene, product, method pages)
References
See Help:References for how to manage references in EcoliWiki.