ssb:Gene
{{#css:Suppresslinks.css}}<css>h1 .editsection { display:none;} h2 .editsection { display:none;}</css>
| Quickview | Gene | Gene Product(s) | Expression | Evolution | On One Page |
| Nomenclature | Location(s) and DNA Sequence | Sequence Features | Alleles and Phenotypes | Genetic Interactions | Genetic Resources | Accessions | Links | References | Suggestions |
<protect>
Nomenclature
See Help:Gene_nomenclature for help with entering information in the Gene Nomenclature table.
| Standard name |
ssb |
|---|---|
| Mnemonic |
Single-strand binding |
| Synonyms |
ECK4051, b4059, JW4020, exrB, lexC[1], lexC |
| edit table |
</protect>
Notes
Location(s) and DNA Sequence
<protect>
See Help:Gene_location for help entering information in the Gene Location and DNA sequence table.
| Strain | Map location | Genome coordinates | Genome browsers | Sequence links |
|---|---|---|---|---|
|
MG1655 |
92.08 minutes, 92.08 minutes |
MG1655: 4272148..4272684 |
||
|
NC_012967: 4253058..4253594 |
||||
|
NC_012759: 4210993..4211529 |
||||
|
W3110 |
|
W3110: 4277715..4278251 |
||
|
DH10B: 4371844..4372380 |
||||
| edit table |
</protect>
Notes
Sequence Features
See Help:Gene_sequence_features for help in entering sequence features in EcoliWiki.
| Feature Type | Strain | Genomic Location | Evidence | Reference | Notes |
|---|---|---|---|---|---|
|
Coding Start (SO:0000323) |
4272151 |
Edman degradation |
| ||
| edit table |
<protect></protect>
Notes
Alleles and Phenotypes
See Help:Gene_alleles for how to enter or edit alleles and phenotypes in EcoliWiki.
| Allele | Nt change(s) | AA change(s) | Phenotype: Type | Phenotype: Description | Reference | Availability | Comments |
|---|---|---|---|---|---|---|---|
|
ssbH56L |
H56L |
Reduces DNA-binding affinity |
seeded from UniProt:P0AGE0 | ||||
|
ssbL11F |
L11F |
Increased frequency of precise excision of transposon Tn10 derivatives (mutant SSB-202) |
seeded from UniProt:P0AGE0 | ||||
|
ssbP25S |
P25S |
Increased frequency of precise excision of transposon Tn10 derivatives (mutant SSB-202) |
seeded from UniProt:P0AGE0 | ||||
|
ssbG5D |
G5D |
Increased frequency of precise excision of transposon Tn10 derivatives (mutant SSB-200) |
seeded from UniProt:P0AGE0 | ||||
|
ssbH56Y |
H56Y |
Destabilizes the tetramer (mutant SSB-1) |
seeded from UniProt:P0AGE0 | ||||
|
ssbF61A |
F61A |
Reduces DNA-binding affinity |
seeded from UniProt:P0AGE0 | ||||
|
ssbV103M |
V103M |
Increased frequency of precise excision of transposon Tn10 derivatives (mutant SSB-201) |
seeded from UniProt:P0AGE0 | ||||
|
ssb-113(ts) |
temperature sensitive |
||||||
|
ssb-1(ts) |
temperature sensitive |
| |||||
| edit table |
<protect></protect>
Notes
Genetic Interactions
<protect>
| Interactor | Interaction | Allele | Score(s) | Reference(s) | Accessions | Notes |
|---|---|---|---|---|---|---|
| edit table |
</protect>
Notes
Genetic Resources
See Help:Gene_resources for help entering information into the Genetic Resources table.
| Resource | Resource Type | Source | Notes/Reference |
|---|---|---|---|
|
JW4020 |
Plasmid clone |
Status:Clone OK Primer 1:GCCGCCAGCAGAGGCGTAAACAA Primer 2:CCGAACGGAATGTCATCATCAAA | |
|
Kohara Phage |
|||
|
Kohara Phage |
|||
|
Linked marker |
est. P1 cotransduction: 29% [9] | ||
|
Linked marker |
est. P1 cotransduction: 26% [9] | ||
| edit table |
<protect></protect>
Notes
Accessions in Other Databases
See Help:Gene_accessions for help with entering information into the Gene Accessions table.
| Database | Accession | Notes |
|---|---|---|
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
|
Escherichia coli str. K-12 substr. MG1655 | ||
| edit table |
<protect></protect>
Notes
Links
| Name | URL | Comments |
|---|---|---|
| edit table |
<protect>
References
See Help:References for how to manage references in EcoliWiki.
- ↑ Riley, M. et al. (2006) Nucleic Acids Res 34:1-6 (corrected supplemental data from B. Wanner)
- ↑ Sancar, A et al. (1981) Sequences of the ssb gene and protein. Proc. Natl. Acad. Sci. U.S.A. 78 4274-8 PubMed
- ↑ Beyreuther, K et al. (1982) Biological activity and a partial amino-acid sequence of Escherichia coli DNA-binding protein I isolated from overproducing cells. Eur. J. Biochem. 123 415-20 PubMed
- ↑ Johnson, BF (1977) Genetic mapping of the lexC-113 mutation. Mol. Gen. Genet. 157 91-7 PubMed
- ↑ Golub, EI & Low, KB (1985) Conjugative plasmids of enteric bacteria from many different incompatibility groups have similar genes for single-stranded DNA-binding proteins. J. Bacteriol. 162 235-41 PubMed
- ↑ Kitagawa, M et al. (2005) Complete set of ORF clones of Escherichia coli ASKA library (a complete set of E. coli K-12 ORF archive): unique resources for biological research. DNA Res. 12 291-9 PubMed
- ↑ 7.0 7.1 Kohara, Y et al. (1987) The physical map of the whole E. coli chromosome: application of a new strategy for rapid analysis and sorting of a large genomic library. Cell 50 495-508 PubMed
- ↑ 8.0 8.1 CGSC: The Coli Genetics Stock Center
- ↑ 9.0 9.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).