recJ:Gene - Revision history

127.0.0.1: touch

2013-09-19T20:44:54Z

touch

← Older revision		Revision as of 20:44, 19 September 2013
Line 128:		Line 128:
	\|		\|
	W3110: 3036762..3035029<br /><gbrowseImage>		W3110: 3036762..3035029<br /><gbrowseImage>
	name=~~AC_000091~~:3035029..3036762		name=NC_007779:3035029..3036762
	source=W3110		source=W3110
	preset=GeneLocation		preset=GeneLocation
Line 134:		Line 134:

	\|		\|
	{{GBrowseLink\|W3110\|~~AC_000091~~\|3034029\|3037762\|GBrowse(W3110)}}		{{GBrowseLink\|W3110\|NC_007779\|3034029\|3037762\|GBrowse(W3110)}}
	\|		\|
	{{GBrowseFastaLink\|W3110\|~~AC_000091~~\|3035029\|3036762\|FASTA Dump}}		{{GBrowseFastaLink\|W3110\|NC_007779\|3035029\|3036762\|FASTA Dump}}
	\|-		\|-
	\|		\|
Line 514:		Line 514:
	\|-		\|-
	\|		\|
	~~[http://www.ncbi.nlm.nih.gov/gene NCBI] (~~[[~~NCBI\|EcoliWiki Page~~]])		[[RegulonDB]]
	\|		\|
	~~[http~~:~~//www.ncbi.nlm.nih.gov/gene?term=947367 GeneID:947367]~~		RegulonDB:ECK120000821
	\|		\|
	Escherichia coli str. K-12 substr. MG1655		''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]
	\|-		\|-
	\|		\|
	[[~~RegulonDB~~]]		[http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI\|EcoliWiki Page]])
	\|		\|
	~~RegulonDB~~:~~ECK120000821~~		[http://www.ncbi.nlm.nih.gov/gene?term=947367 GeneID:947367]
	\|		\|
	''Escherichia coli'' str. K-12 substr. ~~[[:Category:Strain:~~MG1655~~\|MG1655]]~~		Escherichia coli str. K-12 substr. MG1655
	\|-		\|-
	\|		\|

127.0.0.1: touch

2013-05-27T07:27:29Z

touch

← Older revision		Revision as of 07:27, 27 May 2013
Line 67:		Line 67:
	*		*
	****************************************************************************************** -->{{Gene_location_help}}		****************************************************************************************** -->{{Gene_location_help}}
	{\| id="Q46a9e8b550bcc" class=" tableEdit Gene_location_table"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="Q46a9e8b550bcc" class=" tableEdit Gene_location_table"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links		!\|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links
Line 172:		Line 172:
	*		*
	****************************************************************************************** -->{{Gene_sequence_features_help}}		****************************************************************************************** -->{{Gene_sequence_features_help}}
	{\| id="O46a9e8b60cf78" class=" tableEdit Gene_sequence_features_table"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="O46a9e8b60cf78" class=" tableEdit Gene_sequence_features_table"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes		!\|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes
Line 194:		Line 194:
	*		*
	****************************************************************************************** -->{{Gene_alleles_help}}		****************************************************************************************** -->{{Gene_alleles_help}}
	{\| ~~{{Prettytable}}~~ id="U46a9e8b65428d" class=" tableEdit Gene_allele_table dataTable"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="U46a9e8b65428d" class=" tableEdit Gene_allele_table dataTable"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments		!\|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments
Line 391:		Line 391:
	*		*
	****************************************************************************************** -->{{Genetic_interaction_help}}		****************************************************************************************** -->{{Genetic_interaction_help}}
	{\| id="N4e04c22cf39a1" class=" tableEdit Genetic_interaction_table dataTable"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="N4e04c22cf39a1" class=" tableEdit Genetic_interaction_table dataTable"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes		!\|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes
Line 412:		Line 412:
	*		*
	****************************************************************************************** -->{{Gene_resources_help}}		****************************************************************************************** -->{{Gene_resources_help}}
	{\| id="T46a9e8b710fcc" class=" tableEdit Gene_resource_table"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="T46a9e8b710fcc" class=" tableEdit Gene_resource_table"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Resource!!Resource Type!!Source!!Notes/Reference		!\|Resource!!Resource Type!!Source!!Notes/Reference
Line 495:		Line 495:
	*		*
	****************************************************************************************** -->{{Gene_accessions_help}}		****************************************************************************************** -->{{Gene_accessions_help}}
	{\| id="B46a9e8b7aa66f" class=" tableEdit Gene_accessions_table"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="B46a9e8b7aa66f" class=" tableEdit Gene_accessions_table"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Database!!Accession!!Notes		!\|Database!!Accession!!Notes
	\|-		\|-
	\|		\|
	~~[http://ecocyc.org EcoCyc] (~~[[EcoCyc~~\|EcoliWiki Page~~]])		[[EcoCyc]]
	\|		\|
	~~[http~~:~~//biocyc.org/ECOLI/NEW-IMAGE?type=NIL&object=~~EG10830 ~~ECOCYC:EG10830]~~		EcoCyc:EG10830
	\|		\|
	Escherichia coli str. K-12 substr. MG1655		''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]
	\|-		\|-
	\|		\|
	~~[http://ecogene.org EcoGene] (~~[[EcoGene~~\|EcoliWiki Page~~]])		[[EcoGene]]
	\|		\|
	~~[http://ecogene.org/geneinfo.php?eg_id=EG10830~~ EcoGene:EG10830]		EcoGene:EG10830
	\|		\|
	Escherichia coli str. K-12 substr. MG1655		''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]
	\|-		\|-
	\|		\|
Line 519:		Line 519:
	\|		\|
	Escherichia coli str. K-12 substr. MG1655		Escherichia coli str. K-12 substr. MG1655
			\|-
			\|
			[[RegulonDB]]
			\|
			RegulonDB:ECK120000821
			\|
			''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]
			\|-
			\|
			[[EchoBASE]]
			\|
			EchoBASE:EB0823
			\|
			''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]
			\|-
			\|
			[[ASAP]]
			\|
			ASAP:ABE-0009492
			\|
			''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]

	\|- class="tableEdit_footer"		\|- class="tableEdit_footer"
Line 538:		Line 559:
	*		*
	****************************************************************************************** -->		****************************************************************************************** -->
	{\| id="Y46a704d3eefc0" class=" tableEdit Links_table"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="Y46a704d3eefc0" class=" tableEdit Links_table"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Name!!URL!!Comments		!\|Name!!URL!!Comments

Chrischen: Table edited by Chrischen via TableEdit

2012-04-24T22:51:13Z

Table edited by Chrischen via TableEdit

← Older revision		Revision as of 22:51, 24 April 2012
Line 339:		Line 339:
	\|-		\|-
	\|		\|
	''recJ284::~~Tn10~~ (KD2238)''		''recJ284''::Tn''10'' (KD2238)
	\|		\|

Chrischen: Table edited by Chrischen via TableEdit

2012-04-24T22:42:52Z

Table edited by Chrischen via TableEdit

← Older revision		Revision as of 22:42, 24 April 2012
Line 339:		Line 339:
	\|-		\|-
	\|		\|
	''~~KD2238~~ recJ284::Tn10''		''recJ284::Tn10 (KD2238)''
	\|		\|

Chrischen: Table edited by Chrischen via TableEdit

2012-04-24T22:41:14Z

Table edited by Chrischen via TableEdit

← Older revision		Revision as of 22:41, 24 April 2012
Line 339:		Line 339:
	\|-		\|-
	\|		\|
	''recJ284::Tn10''		''KD2238 recJ284::Tn10''
	\|		\|

Line 345:		Line 345:

	\|		\|
			Resistant to
	\|		\|
			Mutation increases resistance to Thymineless Death (TLD). Figure 1.
	\|		\|
			PMID:2848620
	\|		\|
	[[cgscmutation:72003\|CGSC:72003]]		[[cgscmutation:72003\|CGSC:72003]]
	\|		\|
			Parent Strain: KD2197
	\|-		\|-
	\|		\|

imported>Wikientrybot: Refreshing information from GenBank record NC_000913

2011-09-24T18:49:57Z

Refreshing information from GenBank record NC_000913

@@ Line 46: / Line 46: @@
 !align=left {{table_heading_style}} |Synonyms
 ||
-''ECK2887, b2892, JW2860''<ref name='LIB:Riley_2006'/>
+''ECK2887, b2892, JW2860''<ref name='LIB:Riley_2006'/>, JW2860''
 |- class="tableEdit_footer"
@@ Line 498: / Line 498: @@
 |- {{table_heading_style}}
 !|Database!!Accession!!Notes
 |- class="tableEdit_footer"

imported>Wikientrybot: Bulk deleting accessions.

2011-09-21T21:16:11Z

Bulk deleting accessions.

@@ Line 446: / Line 446: @@
+|
 [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=468 Genobase]
+|
 PMID:3038334
@@ Line 467: / Line 476: @@
 est. P1 cotransduction: 9% <ref name='LIB:Nichols_linked_Tn'/> <br />
 Synonyms:zgd-210::Tn10, zgf-210::Tn10
 |- class="tableEdit_footer"
@@ Line 498: / Line 498: @@
 |- {{table_heading_style}}
 !|Database!!Accession!!Notes
 |- class="tableEdit_footer"

127.0.0.1: Data loaded by TableEdit_Loader.

2011-09-02T21:14:25Z

Data loaded by TableEdit_Loader.

← Older revision		Revision as of 21:14, 2 September 2011
Line 437:		Line 437:
	\|		\|
	[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=467 Genobase]		[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=467 Genobase]
			\|
			PMID:3038334
			\|-
			\|
			[[:Category:Kohara_Phage:22H4\|22H4]]
			\|
			Kohara Phage
			\|
			[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=468 Genobase]
	\|		\|
	PMID:3038334		PMID:3038334
Line 460:		Line 469:
	\|-		\|-
	\|		\|
	[[:Category:Kohara_Phage:~~22H4~~\|~~22H4~~]]		[[:Category:Kohara_Phage:5E11\|5E11]]
	\|		\|
	Kohara Phage		Kohara Phage
	\|		\|
	[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=~~468~~ Genobase]		[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=469 Genobase]
	\|		\|
	PMID:3038334		PMID:3038334

127.0.0.1: Data loaded by TableEdit_Loader.

2011-09-02T21:14:14Z

Data loaded by TableEdit_Loader.

← Older revision		Revision as of 21:14, 2 September 2011
Line 430:		Line 430:

	Primer 2:CCAATTGGCCAGATATTGTCGAT		Primer 2:CCAATTGGCCAGATATTGTCGAT
			\|-
			\|
			[[:Category:Kohara_Phage:5B4\|5B4]]
			\|
			Kohara Phage
			\|
			[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=467 Genobase]
			\|
			PMID:3038334
	\|-		\|-
	\|		\|
Line 451:		Line 460:
	\|-		\|-
	\|		\|
	[[:Category:Kohara_Phage:~~5B4~~\|~~5B4~~]]		[[:Category:Kohara_Phage:22H4\|22H4]]
	\|		\|
	Kohara Phage		Kohara Phage
	\|		\|
	[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=~~467~~ Genobase]		[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=468 Genobase]
	\|		\|
	PMID:3038334		PMID:3038334

127.0.0.1: Data loaded by TableEdit_Loader.

2011-09-02T21:14:07Z

Data loaded by TableEdit_Loader.

← Older revision		Revision as of 21:14, 2 September 2011
Line 449:		Line 449:
	est. P1 cotransduction: 9% <ref name='LIB:Nichols_linked_Tn'/> <br />		est. P1 cotransduction: 9% <ref name='LIB:Nichols_linked_Tn'/> <br />
	Synonyms:zgd-210::Tn10, zgf-210::Tn10		Synonyms:zgd-210::Tn10, zgf-210::Tn10
			\|-
			\|
			[[:Category:Kohara_Phage:5B4\|5B4]]
			\|
			Kohara Phage
			\|
			[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=467 Genobase]
			\|
			PMID:3038334

	\|- class="tableEdit_footer"		\|- class="tableEdit_footer"