recC:Gene - Revision history

127.0.0.1: touch

2013-09-19T20:44:32Z

touch

← Older revision		Revision as of 20:44, 19 September 2013
Line 128:		Line 128:
	\|		\|
	W3110: 2961084..2957716<br /><gbrowseImage>		W3110: 2961084..2957716<br /><gbrowseImage>
	name=~~AC_000091~~:2957716..2961084		name=NC_007779:2957716..2961084
	source=W3110		source=W3110
	preset=GeneLocation		preset=GeneLocation
Line 134:		Line 134:

	\|		\|
	{{GBrowseLink\|W3110\|~~AC_000091~~\|2956716\|2962084\|GBrowse(W3110)}}		{{GBrowseLink\|W3110\|NC_007779\|2956716\|2962084\|GBrowse(W3110)}}
	\|		\|
	{{GBrowseFastaLink\|W3110\|~~AC_000091~~\|2957716\|2961084\|FASTA Dump}}		{{GBrowseFastaLink\|W3110\|NC_007779\|2957716\|2961084\|FASTA Dump}}
	\|-		\|-
	\|		\|
Line 532:		Line 532:
	\|-		\|-
	\|		\|
	~~[http://www.ncbi.nlm.nih.gov/gene NCBI] (~~[[~~NCBI\|EcoliWiki Page~~]])		[[RegulonDB]]
	\|		\|
	~~[http~~:~~//www.ncbi.nlm.nih.gov/gene?term=947294 GeneID:947294]~~		RegulonDB:ECK120000816
	\|		\|
	Escherichia coli str. K-12 substr. MG1655		''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]
	\|-		\|-
	\|		\|
	[[~~RegulonDB~~]]		[http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI\|EcoliWiki Page]])
	\|		\|
	~~RegulonDB~~:~~ECK120000816~~		[http://www.ncbi.nlm.nih.gov/gene?term=947294 GeneID:947294]
	\|		\|
	''Escherichia coli'' str. K-12 substr. ~~[[:Category:Strain:~~MG1655~~\|MG1655]]~~		Escherichia coli str. K-12 substr. MG1655
	\|-		\|-
	\|		\|

127.0.0.1: touch

2013-05-27T07:27:06Z

touch

← Older revision		Revision as of 07:27, 27 May 2013
Line 67:		Line 67:
	*		*
	****************************************************************************************** -->{{Gene_location_help}}		****************************************************************************************** -->{{Gene_location_help}}
	{\| id="R46a9e71a76b06" class=" tableEdit Gene_location_table"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="R46a9e71a76b06" class=" tableEdit Gene_location_table"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links		!\|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links
Line 172:		Line 172:
	*		*
	****************************************************************************************** -->{{Gene_sequence_features_help}}		****************************************************************************************** -->{{Gene_sequence_features_help}}
	{\| id="W46a9e71b33111" class=" tableEdit Gene_sequence_features_table"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="W46a9e71b33111" class=" tableEdit Gene_sequence_features_table"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes		!\|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes
Line 418:		Line 418:
	*		*
	****************************************************************************************** -->{{Genetic_interaction_help}}		****************************************************************************************** -->{{Genetic_interaction_help}}
	{\| id="J4e04c22730b25" class=" tableEdit Genetic_interaction_table dataTable"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="J4e04c22730b25" class=" tableEdit Genetic_interaction_table dataTable"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes		!\|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes
Line 439:		Line 439:
	*		*
	****************************************************************************************** -->{{Gene_resources_help}}		****************************************************************************************** -->{{Gene_resources_help}}
	{\| id="H46a9e71c35d6b" class=" tableEdit Gene_resource_table"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="H46a9e71c35d6b" class=" tableEdit Gene_resource_table"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Resource!!Resource Type!!Source!!Notes/Reference		!\|Resource!!Resource Type!!Source!!Notes/Reference
Line 513:		Line 513:
	*		*
	****************************************************************************************** -->{{Gene_accessions_help}}		****************************************************************************************** -->{{Gene_accessions_help}}
	{\| id="F46a9e71cce5da" class=" tableEdit Gene_accessions_table"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="F46a9e71cce5da" class=" tableEdit Gene_accessions_table"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Database!!Accession!!Notes		!\|Database!!Accession!!Notes
	\|-		\|-
	\|		\|
	~~[http://ecocyc.org EcoCyc] (~~[[EcoCyc~~\|EcoliWiki Page~~]])		[[EcoCyc]]
	\|		\|
	~~[http~~:~~//biocyc.org/ECOLI/NEW-IMAGE?type=NIL&object=~~EG10825 ~~ECOCYC:EG10825]~~		EcoCyc:EG10825
	\|		\|
	Escherichia coli str. K-12 substr. MG1655		''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]
	\|-		\|-
	\|		\|
	~~[http://ecogene.org EcoGene] (~~[[EcoGene~~\|EcoliWiki Page~~]])		[[EcoGene]]
	\|		\|
	~~[http://ecogene.org/geneinfo.php?eg_id=EG10825~~ EcoGene:EG10825]		EcoGene:EG10825
	\|		\|
	Escherichia coli str. K-12 substr. MG1655		''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]
	\|-		\|-
	\|		\|
Line 537:		Line 537:
	\|		\|
	Escherichia coli str. K-12 substr. MG1655		Escherichia coli str. K-12 substr. MG1655
			\|-
			\|
			[[RegulonDB]]
			\|
			RegulonDB:ECK120000816
			\|
			''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]
			\|-
			\|
			[[EchoBASE]]
			\|
			EchoBASE:EB0818
			\|
			''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]
			\|-
			\|
			[[ASAP]]
			\|
			ASAP:ABE-0009255
			\|
			''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]

	\|- class="tableEdit_footer"		\|- class="tableEdit_footer"
Line 556:		Line 577:
	*		*
	****************************************************************************************** -->		****************************************************************************************** -->
	{\| id="U46a7035e0a1b3" class=" tableEdit Links_table"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="U46a7035e0a1b3" class=" tableEdit Links_table"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Name!!URL!!Comments		!\|Name!!URL!!Comments

Wameza: Table edited by Wameza via TableEdit

2013-01-22T18:40:58Z

Table edited by Wameza via TableEdit

← Older revision		Revision as of 18:40, 22 January 2013
Line 388:		Line 388:

	\|		\|
			SOS-Induction
	\|		\|
			Decrease in spontaneous SOS-Induction
	\|		\|
			PMID:23224554
	\|		\|
			Parent Strain: SMR11941
			Experimental Strain: SMR17043
	\|		\|
			The mutation conferred a decrease in spontaneous SOS-induction. See table S7 for a summary of results.

	\|- class="tableEdit_footer"		\|- class="tableEdit_footer"

Wameza: Table edited by Wameza via TableEdit

2013-01-22T17:40:33Z

Table edited by Wameza via TableEdit

@@ Line 207: / Line 207: @@
+*
 ****************************************************************************************** -->{{Gene_alleles_help}}
-{| {{Prettytable}}  id="Q46a9e71b7a05f"  class=" tableEdit Gene_allele_table dataTable"
+{| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"  id="Q46a9e71b7a05f"  class=" tableEdit Gene_allele_table dataTable"
 |- {{table_heading_style}}
 !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments
@@ Line 380: / Line 380: @@
+|
 fig 2
 |- class="tableEdit_footer"

Wameza: Table edited by Wameza via TableEdit

2012-02-13T18:28:00Z

Table edited by Wameza via TableEdit

← Older revision		Revision as of 18:28, 13 February 2012
Line 212:		Line 212:
	\|-		\|-
	\|		\|
	~~Δ~~recC (Keio:JW2790)		''recC(del)'' (Keio:JW2790)
	\|		\|
	deletion		deletion

Denham: Table edited by Denham via TableEdit

2011-10-06T15:50:17Z

Table edited by Denham via TableEdit

← Older revision		Revision as of 15:50, 6 October 2011
Line 373:		Line 373:
	Sensitivity to		Sensitivity to
	\|		\|
	decreases sensitivity to ~~bicyclomycin~~		decreases sensitivity to [[Bicyclomycin]]
	\|		\|
	PMID:21357484		PMID:21357484

Denham: Table edited by Denham via TableEdit

2011-09-29T13:07:23Z

Table edited by Denham via TableEdit

← Older revision		Revision as of 13:07, 29 September 2011
Line 363:		Line 363:
	\|		\|

			\|-
			\|
			recC
			\|
			deletion
			\|

			\|
			Sensitivity to
			\|
			decreases sensitivity to bicyclomycin
			\|
			PMID:21357484
			\|

			\|
			fig 2

	\|- class="tableEdit_footer"		\|- class="tableEdit_footer"

imported>Wikientrybot: Refreshing information from GenBank record NC_000913

2011-09-24T18:37:26Z

Refreshing information from GenBank record NC_000913

@@ Line 46: / Line 46: @@
 !align=left {{table_heading_style}} |Synonyms
 ||
-''ECK2818, b2822, JW2790''<ref name='LIB:Riley_2006'/>
+''ECK2818, b2822, JW2790''<ref name='LIB:Riley_2006'/>, JW2790''
 |- class="tableEdit_footer"
@@ Line 481: / Line 481: @@
 |- {{table_heading_style}}
 !|Database!!Accession!!Notes
 |- class="tableEdit_footer"

imported>Wikientrybot: Bulk deleting accessions.

2011-09-21T21:15:55Z

Bulk deleting accessions.

@@ Line 429: / Line 429: @@
+|
 [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=460 Genobase]
+|
 PMID:3038334
@@ Line 450: / Line 459: @@
 est. P1 cotransduction: % <ref name='LIB:Nichols_linked_Tn'/> <br />
 Synonyms:zgd-210::Tn10, zgf-210::Tn10
 |- class="tableEdit_footer"
@@ Line 481: / Line 481: @@
 |- {{table_heading_style}}
 !|Database!!Accession!!Notes
 |- class="tableEdit_footer"

127.0.0.1: Data loaded by TableEdit_Loader.

2011-09-02T21:12:36Z

Data loaded by TableEdit_Loader.

← Older revision		Revision as of 21:12, 2 September 2011
Line 422:		Line 422:

	Primer 2:CCTGACTGATTAAAGCGAAACAG		Primer 2:CCTGACTGATTAAAGCGAAACAG
			\|-
			\|
			[[:Category:Kohara_Phage:3G11\|3G11]]
			\|
			Kohara Phage
			\|
			[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=460 Genobase]
			\|
			PMID:3038334
	\|-		\|-
	\|		\|
Line 443:		Line 452:
	\|-		\|-
	\|		\|
	[[:Category:Kohara_Phage:~~3G11~~\|~~3G11~~]]		[[:Category:Kohara_Phage:5A10\|5A10]]
	\|		\|
	Kohara Phage		Kohara Phage
	\|		\|
	[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=~~460~~ Genobase]		[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=461 Genobase]
	\|		\|
	PMID:3038334		PMID:3038334