hns:Gene - Revision history

127.0.0.1: touch

2013-09-19T20:30:27Z

touch

← Older revision		Revision as of 20:30, 19 September 2013
Line 128:		Line 128:
	\|		\|
	W3110: 1294499..1294086<br /><gbrowseImage>		W3110: 1294499..1294086<br /><gbrowseImage>
	name=~~AC_000091~~:1294086..1294499		name=NC_007779:1294086..1294499
	source=W3110		source=W3110
	preset=GeneLocation		preset=GeneLocation
Line 134:		Line 134:

	\|		\|
	{{GBrowseLink\|W3110\|~~AC_000091~~\|1293086\|1295499\|GBrowse(W3110)}}		{{GBrowseLink\|W3110\|NC_007779\|1293086\|1295499\|GBrowse(W3110)}}
	\|		\|
	{{GBrowseFastaLink\|W3110\|~~AC_000091~~\|1294086\|1294499\|FASTA Dump}}		{{GBrowseFastaLink\|W3110\|NC_007779\|1294086\|1294499\|FASTA Dump}}
	\|-		\|-
	\|		\|
Line 703:		Line 703:
	\|-		\|-
	\|		\|
	~~[http://www.ncbi.nlm.nih.gov/gene NCBI] (~~[[~~NCBI\|EcoliWiki Page~~]])		[[RegulonDB]]
	\|		\|
	~~[http~~:~~//www.ncbi.nlm.nih.gov/gene?term=945829 GeneID:945829]~~		RegulonDB:ECK120000450
	\|		\|
	Escherichia coli str. K-12 substr. MG1655		''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]
	\|-		\|-
	\|		\|
	[[~~RegulonDB~~]]		[http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI\|EcoliWiki Page]])
	\|		\|
	~~RegulonDB~~:~~ECK120000450~~		[http://www.ncbi.nlm.nih.gov/gene?term=945829 GeneID:945829]
	\|		\|
	''Escherichia coli'' str. K-12 substr. ~~[[:Category:Strain:~~MG1655~~\|MG1655]]~~		Escherichia coli str. K-12 substr. MG1655
	\|-		\|-
	\|		\|

127.0.0.1: touch

2013-05-27T07:13:09Z

touch

← Older revision		Revision as of 07:13, 27 May 2013
Line 67:		Line 67:
	*		*
	****************************************************************************************** -->{{Gene_location_help}}		****************************************************************************************** -->{{Gene_location_help}}
	{\| id="L46a9c2b1c59e1" class=" tableEdit Gene_location_table"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="L46a9c2b1c59e1" class=" tableEdit Gene_location_table"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links		!\|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links
Line 172:		Line 172:
	*		*
	****************************************************************************************** -->{{Gene_sequence_features_help}}		****************************************************************************************** -->{{Gene_sequence_features_help}}
	{\| id="X46a9c2b2729c5" class=" tableEdit Gene_sequence_features_table"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="X46a9c2b2729c5" class=" tableEdit Gene_sequence_features_table"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes		!\|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes
Line 207:		Line 207:
	*		*
	****************************************************************************************** -->{{Gene_alleles_help}}		****************************************************************************************** -->{{Gene_alleles_help}}
	{\| ~~{{Prettytable}}~~ id="P46a9c2b2b4118" class=" tableEdit Gene_allele_table dataTable"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="P46a9c2b2b4118" class=" tableEdit Gene_allele_table dataTable"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments		!\|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments
Line 589:		Line 589:
	*		*
	****************************************************************************************** -->{{Genetic_interaction_help}}		****************************************************************************************** -->{{Genetic_interaction_help}}
	{\| id="P4e04bd182e8da" class=" tableEdit Genetic_interaction_table dataTable"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="P4e04bd182e8da" class=" tableEdit Genetic_interaction_table dataTable"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes		!\|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes
Line 610:		Line 610:
	*		*
	****************************************************************************************** -->{{Gene_resources_help}}		****************************************************************************************** -->{{Gene_resources_help}}
	{\| id="L46a9c2b361571" class=" tableEdit Gene_resource_table"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="L46a9c2b361571" class=" tableEdit Gene_resource_table"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Resource!!Resource Type!!Source!!Notes/Reference		!\|Resource!!Resource Type!!Source!!Notes/Reference
Line 684:		Line 684:
	*		*
	****************************************************************************************** -->{{Gene_accessions_help}}		****************************************************************************************** -->{{Gene_accessions_help}}
	{\| id="N46a9c2b3edb75" class=" tableEdit Gene_accessions_table"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="N46a9c2b3edb75" class=" tableEdit Gene_accessions_table"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Database!!Accession!!Notes		!\|Database!!Accession!!Notes
	\|-		\|-
	\|		\|
	~~[http://ecocyc.org EcoCyc] (~~[[EcoCyc~~\|EcoliWiki Page~~]])		[[EcoCyc]]
	\|		\|
	~~[http~~:~~//biocyc.org/ECOLI/NEW-IMAGE?type=NIL&object=~~EG10457 ~~ECOCYC:EG10457]~~		EcoCyc:EG10457
	\|		\|
	Escherichia coli str. K-12 substr. MG1655		''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]
	\|-		\|-
	\|		\|
	~~[http://ecogene.org EcoGene] (~~[[EcoGene~~\|EcoliWiki Page~~]])		[[EcoGene]]
	\|		\|
	~~[http://ecogene.org/geneinfo.php?eg_id=EG10457~~ EcoGene:EG10457]		EcoGene:EG10457
	\|		\|
	Escherichia coli str. K-12 substr. MG1655		''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]
	\|-		\|-
	\|		\|
Line 708:		Line 708:
	\|		\|
	Escherichia coli str. K-12 substr. MG1655		Escherichia coli str. K-12 substr. MG1655
			\|-
			\|
			[[RegulonDB]]
			\|
			RegulonDB:ECK120000450
			\|
			''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]
			\|-
			\|
			[[EchoBASE]]
			\|
			EchoBASE:EB0452
			\|
			''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]
			\|-
			\|
			[[ASAP]]
			\|
			ASAP:ABE-0004152
			\|
			''Escherichia coli'' str. K-12 substr. [[:Category:Strain:MG1655\|MG1655]]

	\|- class="tableEdit_footer"		\|- class="tableEdit_footer"
Line 727:		Line 748:
	*		*
	****************************************************************************************** -->		****************************************************************************************** -->
	{\| id="O46a6e029c1ee5" class=" tableEdit Links_table"		{\| border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" id="O46a6e029c1ee5" class=" tableEdit Links_table"
	\|- {{table_heading_style}}		\|- {{table_heading_style}}
	!\|Name!!URL!!Comments		!\|Name!!URL!!Comments

Joncrz: Table edited by Joncrz via TableEdit

2012-02-28T23:56:51Z

Table edited by Joncrz via TableEdit

← Older revision		Revision as of 23:56, 28 February 2012
Line 552:		Line 552:
	\|		\|

			\|-
			\|
			''bglY203''
			\|

			\|

			\|
			Carbon utilization
			\|
			able to utilize arbutin and salicin as a carbon source, table 3.
			\|
			PMID:6266910
			\|
			FA35, FA37, FA39, FS20, FS29
			\|
			Mutations also utilizing similar carbon sources are: ''bglY204'', ''bglY205'', ''bglY206'', ''bglY207''

	\|- class="tableEdit_footer"		\|- class="tableEdit_footer"

Joncrz: Table edited by Joncrz via TableEdit

2012-02-28T23:52:02Z

Table edited by Joncrz via TableEdit

← Older revision		Revision as of 23:52, 28 February 2012
Line 533:		Line 533:
	\|		\|

			\|

			\|-
			\|
			''bglY202''
			\|

			\|

			\|
			Carbon utilization
			\|
			Utilization of arbutin (a Beta-glucoside) as a carbon source, table 3.
			\|
			PMID:6266910
			\|
			Experimental Strain: FA31
	\|		\|

Joncrz: Table edited by Joncrz via TableEdit

2012-02-06T23:29:13Z

Table edited by Joncrz via TableEdit

@@ Line 518: / Line 518: @@
+|
 fig 2
 |- class="tableEdit_footer"

Joncrz: Table edited by Joncrz via TableEdit

2012-02-06T23:18:32Z

Table edited by Joncrz via TableEdit

← Older revision		Revision as of 23:18, 6 February 2012
Line 212:		Line 212:
	\|-		\|-
	\|		\|
	~~Δ~~hns (Keio:JW1225)		''hns(del)'' (Keio:JW1225)
	\|		\|
	deletion		deletion
Line 224:		Line 224:
	PMID:16738554		PMID:16738554
	\|		\|
	[http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]~~<br>~~[http://cgsc2.biology.yale.edu/Strain.php?ID=107392 CGSC9111]<ref name='LIB:cgsc'/>		[http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]

			[http://cgsc2.biology.yale.edu/Strain.php?ID=107392 CGSC9111]<ref name='LIB:cgsc'/>
	\|		\|

Line 246:		Line 248:
	\|-		\|-
	\|		\|
	~~Δ~~hns::kan		''hns(del)::kan''
	\|		\|
	deletion		deletion
Line 263:		Line 265:
	\|-		\|-
	\|		\|
	~~Δ~~hns::kan		''hns(del)''::kan
	\|		\|
	deletion		deletion
Line 280:		Line 282:
	\|-		\|-
	\|		\|
	~~Δ~~hns::kan		''hns(del)''::kan
	\|		\|
	deletion		deletion
Line 297:		Line 299:
	\|-		\|-
	\|		\|
	~~Δ~~hns::kan		''hns(del)''::kan
	\|		\|
	deletion		deletion
Line 314:		Line 316:
	\|-		\|-
	\|		\|
	~~Δ~~hns::kan		''hns(del)''::kan
	\|		\|
	deletion		deletion
Line 331:		Line 333:
	\|-		\|-
	\|		\|
	~~Δ~~hns::kan		''hns(del)''::kan
	\|		\|
	deletion		deletion
Line 348:		Line 350:
	\|-		\|-
	\|		\|
	~~Δ~~hns::kan		''hns(del)''::kan
	\|		\|
	deletion		deletion
Line 365:		Line 367:
	\|-		\|-
	\|		\|
	~~Δ~~hns::kan		''hns(del)''::kan
	\|		\|
	deletion		deletion
Line 382:		Line 384:
	\|-		\|-
	\|		\|
	~~Δ~~hns::kan		''hns(del)''::kan
	\|		\|
	deletion		deletion
Line 399:		Line 401:
	\|-		\|-
	\|		\|
	~~Δ~~hns::kan		''hns(del)''::kan
	\|		\|
	deletion		deletion
Line 416:		Line 418:
	\|-		\|-
	\|		\|
	~~Δ~~hns::kan		''hns(del)''::kan
	\|		\|
	deletion		deletion
Line 433:		Line 435:
	\|-		\|-
	\|		\|
	~~Δ~~hns::kan		''hns(del)''::kan
	\|		\|
	deletion		deletion
Line 484:		Line 486:
	\|-		\|-
	\|		\|
	''~~Δ~~hns-746::kan''		''hns(del)-746::kan''
	\|		\|

Denham: Table edited by Denham via TableEdit

2011-09-29T13:53:26Z

Table edited by Denham via TableEdit

← Older revision		Revision as of 13:53, 29 September 2011
Line 499:		Line 499:
	\|		\|

			\|-
			\|
			hns
			\|
			deletion
			\|

			\|
			Sensitivity to
			\|
			increases sensitivity to bicyclomycin
			\|
			PMID:21357484
			\|

			\|
			fig 2

	\|- class="tableEdit_footer"		\|- class="tableEdit_footer"

imported>Wikientrybot: Refreshing information from GenBank record NC_000913

2011-09-24T03:40:38Z

Refreshing information from GenBank record NC_000913

@@ Line 46: / Line 46: @@
 !align=left {{table_heading_style}} |Synonyms
 ||
-''ECK1232, b1237, JW1225, bglY, cur, drc, drdX, drs, irk, mssyA, msyA, osmZ, pilG, topX, virR, hnsA, topS, B1, H1''<ref name='LIB:Riley_2006'/>
+''ECK1232, b1237, JW1225, bglY, cur, drc, drdX, drs, irk, mssyA, msyA, osmZ, pilG, topX, virR, hnsA, topS, B1, H1''<ref name='LIB:Riley_2006'/>, fimG, H1, verA''
 |- class="tableEdit_footer"
@@ Line 617: / Line 617: @@
 |- {{table_heading_style}}
 !|Database!!Accession!!Notes
 |- class="tableEdit_footer"

imported>Wikientrybot: Bulk deleting accessions.

2011-09-21T20:23:32Z

Bulk deleting accessions.

@@ Line 565: / Line 565: @@
+|
 [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=250 Genobase]
+|
 PMID:3038334
@@ Line 586: / Line 595: @@
 est. P1 cotransduction: 66% <ref name='LIB:Nichols_linked_Tn'/> <br />
 Synonyms:zch-506::Tn10, zci-506::Tn10
 |- class="tableEdit_footer"
@@ Line 617: / Line 617: @@
 |- {{table_heading_style}}
 !|Database!!Accession!!Notes
 |- class="tableEdit_footer"

127.0.0.1: Data loaded by TableEdit_Loader.

2011-09-02T20:34:49Z

Data loaded by TableEdit_Loader.

← Older revision		Revision as of 20:34, 2 September 2011
Line 558:		Line 558:

	Primer 2:CCTTGCTTGATCAGGAAATCGTC		Primer 2:CCTTGCTTGATCAGGAAATCGTC
			\|-
			\|
			[[:Category:Kohara_Phage:4D8\|4D8]]
			\|
			Kohara Phage
			\|
			[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=250 Genobase]
			\|
			PMID:3038334
	\|-		\|-
	\|		\|
Line 579:		Line 588:
	\|-		\|-
	\|		\|
	[[:Category:Kohara_Phage:~~4D8~~\|~~4D8~~]]		[[:Category:Kohara_Phage:3D5\|3D5]]
	\|		\|
	Kohara Phage		Kohara Phage
	\|		\|
	[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=~~250~~ Genobase]		[http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=251 Genobase]
	\|		\|
	PMID:3038334		PMID:3038334