https://ecoliwiki.org/colipedia/api.php?action=feedcontributions&feedformat=atom&user=SburnEcoliWiki - User contributions [en]2026-11-03T12:43:25ZUser contributionsMediaWiki 1.43.11https://ecoliwiki.org/colipedia/index.php?title=galk2&diff=430696galk22008-05-02T04:16:29Z<p>Sburn: /* Notes */</p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet.<br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=430695galk22008-05-02T04:15:29Z<p>Sburn: /* Notes */</p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet.<br />
<ref name=PMID:15598748/><br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=357911galk22008-02-22T07:10:34Z<p>Sburn: /* Notes */</p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet.<br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=357910galk22008-02-22T07:10:08Z<p>Sburn: /* Notes */</p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet. <ref name=PMID:11711531/><br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=357909galk22008-02-22T03:27:18Z<p>Sburn: /* Notes */</p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet.<br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=357908galk22008-02-22T03:25:10Z<p>Sburn: /* Notes */</p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet. <ref name=PMID:17132729/>, <ref name=PMID:16775010/><br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=357907galk22008-02-22T03:23:39Z<p>Sburn: /* Notes */</p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet. <ref name=PMID:17132729/><br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=357906galk22008-02-22T03:22:44Z<p>Sburn: /* Notes */</p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet. <ref name=PMID:13390972/>, <ref name=PMID:17132729/><br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=357887galk22008-02-21T06:26:40Z<p>Sburn: /* Notes */</p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet.<br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=357886galk22008-02-21T06:25:30Z<p>Sburn: /* Notes */</p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet. <ref name=PMID:11711531/>, <ref name=PMID:15750622/>, <ref name=PMID:14534577/><br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=357885galk22008-02-21T06:23:41Z<p>Sburn: /* Notes */</p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet. <ref name=PMID:17592292/><br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=357884galk22008-02-21T06:21:30Z<p>Sburn: /* Notes */</p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet.<br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=357883galk22008-02-21T06:21:14Z<p>Sburn: /* Notes */</p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet. <ref name=PMID:16775010/><br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=357882galk22008-02-21T06:10:55Z<p>Sburn: /* Notes */</p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet.<br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=357881galk22008-02-21T06:10:15Z<p>Sburn: /* Notes */</p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet. <ref name=PMID:17898532/><br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=357880galk22008-02-21T06:09:55Z<p>Sburn: /* Notes */</p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet. <reg name=PMID:17898532/><br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=357879galk22008-02-21T06:09:21Z<p>Sburn: /* Notes */</p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet. <reg name=PMID:17898532><br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=328148galk22007-11-28T02:41:01Z<p>Sburn: </p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet.<br />
<br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=328147galk22007-11-28T02:40:25Z<p>Sburn: </p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet. <ref name=PMID:17928853/><br />
<br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galK:Gene&diff=320056galK:Gene2007-11-11T16:08:48Z<p>Sburn: /* Notes */</p>
<hr />
<div><!--<br />
***************************************************************************************************************************************************<br />
*<br />
* PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br />
* YOU'RE PROBABLY IN THE WRONG PLACE<br />
*<br />
*<br />
***************************************************************************************************************************************************<br />
-->{{#css:Suppresslinks.css}}<css>{{:Suppresslinks.css}}</css><br />
<noinclude>{{TabsTop}} <br />
{{Tab|Quickview|galK}}{{Tab On|Gene|galK}}{{Tab|Gene Product(s)|galK}}{{Tab|Expression|galK}}{{Tab|Evolution|galK}}{{Tab|On One Page|galK}}{{TabsBottom}}<br />
{|<br />
|- style="background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;" <br />
|{{Sub}}[[#Nomenclature |Nomenclature]]<br />
|{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br />
|{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br />
|{{Sub}}[[#Genetic Resources |Genetic Resources]]<br />
|{{Sub}}[[#Accessions in Other Databases |Accessions]]<br />
|{{Sub}}[[#Links |Links]]<br />
|{{Sub}}[[#References |References]]<br />
|{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br />
|}<br />
</noinclude><protect><br />
==Nomenclature==<br />
{{BacktoTop}}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.T46a9b80370c4a--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|{{Prettytable}}<br />
|-<br />
!{{table_heading_style}} |Standard name<br />
|<br />
''galK'' <br />
|-<br />
!{{table_heading_style}} |Mnemonic<br />
|<br />
<br />
|-<br />
!{{table_heading_style}} |Synonyms<br />
|<br />
''ECK0746, b0757, JW0740, galA''<ref name='LIB:Riley_2006'/><br />
|-<br />
|colspan='2'|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.12069.T46a9b80370c4a&page=12069&pagename={{FULLPAGENAMEE}} edit table]<br />
|}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.T46a9b80370c4a--><br />
{{Gene_nomenclature_help}}<br />
<!--Nomenclature_notes--></protect><br />
===Notes===<br />
<br />
<br />
==Location(s) and DNA Sequence==<br />
{{BacktoTop}}<br />
<protect><br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.Q46a9b803e87f8--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|class = 'sortable' {{Prettytable}} id='129407' <br />
|- {{table_heading_style}}<br />
!Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br />
|-<br />
|<br />
MG1655<br />
|<br />
16.99 minutes&nbsp;<br />
|<br />
MG1655: 789202..788054<br />{{GBrowseFigureByCoord|787054|790202|ecoli|MG1655}} <br />
|<br />
*[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG10363 EcoCyc]<br />
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli/?q=MG1655:787054..790202 GBrowse(MG1655)]<br />
<br />
|<br />
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli/?plugin=FastaDumper&name=MG1655:788054..789202&plugin_action=Go FASTA Dump]<br />
*[http://biocyc.org/ECOLI/sequence?object=EG10363 EcoCyc Sequence Dump] <br />
|-<br />
|<br />
W3110<br />
|<br />
&nbsp;<br />
|<br />
W3110: 790401..789253<br />{{GBrowseFigureByCoord|788253|791401|ecoli_W3110|W3110}} <br />
|<br />
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli_W3110/?q=W3110:788253..791401 GBrowse(W3110)] <br />
|<br />
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli_W3110/?plugin=FastaDumper&name=W3110:789253..790401&plugin_action=Go FASTA Dump] <br />
|-class='sortbottom'<br />
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.12069.Q46a9b803e87f8&page=12069&pagename={{FULLPAGENAMEE}} edit table] || || || ||<br />
|}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.Q46a9b803e87f8--><br />
{{Gene_location_help}}<br />
<!--Location_notes--></protect><br />
===Notes===<br />
<br />
<br />
==Sequence Features==<br />
{{BacktoTop}}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.M46a9b804919fb--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|class = 'sortable' {{Prettytable}} id='129408' <br />
|- {{table_heading_style}}<br />
!Feature type!!Location!!Description<br />
|-class='sortbottom'<br />
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.12069.M46a9b804919fb&page=12069&pagename={{FULLPAGENAMEE}} edit table] || ||<br />
|}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.M46a9b804919fb--><br />
{{Gene_sequence_features_help}}<br />
<protect><!--Sequence_notes--></protect><br />
====Notes====<br />
<br />
<br />
==Alleles and Phenotypes==<br />
{{BacktoTop}}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.T46a9b804d196d--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|class = 'sortable' {{Prettytable}} id='129409' <br />
|- {{table_heading_style}}<br />
!Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br />
|-<br />
|<br />
&Delta;galK (Keio:JW0740)<br />
|<br />
deletion<br />
|<br />
deletion<br />
|<br />
<br />
|<br />
<br />
|<br />
[[PMID:16738554]]<ref name=PMID:16738554/><br />
|<br />
[http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]<br>[http://cgsc2.biology.yale.edu/Strain.php?ID=107084 CGSC8803]<ref name='LIB:cgsc'/> <br />
|<br />
<br />
|-<br />
|<br />
ΔgalK2<br />
|<br />
E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
|<br />
<br />
|<br />
<br />
|<br />
Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
|<br />
[[PMID:17247607]]<ref name=PMID:17247607/> [[PMID:13390972]]<ref name=PMID:13390972/><br />
|<br />
<br />
|<br />
<br />
|-class='sortbottom'<br />
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.12069.T46a9b804d196d&page=12069&pagename={{FULLPAGENAMEE}} edit table] || || || || || || ||<br />
|}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.T46a9b804d196d--><br />
{{Gene_alleles_help}}<br />
<protect><!--Alleles_notes--></protect><br />
===Notes===<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet.<br />
<br />
==Genetic Resources==<br />
{{BacktoTop}}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.G46a9b8057ab70--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|class = 'sortable' {{Prettytable}} id='129410' <br />
|- {{table_heading_style}}<br />
!Resource!!Resource Type!!Source!!Notes/Reference<br />
|-<br />
|<br />
JW0740<br />
|<br />
Plasmid clone<br />
|<br />
[http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br />
|<br />
[[PMID:16769691]]<ref name=PMID:16769691/><br />
<br />
Status:Clone OK<br />
<br />
Primer 1:GCCAGTCTGAAAGAAAAAACACA<br />
<br />
Primer 2:CCGCACTGTCCTGCTCCTTGTGA <br />
|-<br />
|<br />
[[nadA:Gene|nadA57::Tn10]]<br />
|<br />
Linked marker<br />
|<br />
CAG12147 = [http://cgsc2.biology.yale.edu/Strain.php?ID=38017 CGSC7351]<ref name='LIB:cgsc'/><br />
|<br />
est. P1 cotransduction: 75% <ref name='LIB:Nichols_linked_Tn'/> <br />
|-<br />
|<br />
zbh-29::Tn10<br />
|<br />
Linked marker<br />
|<br />
CAG18493 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39400 CGSC7353]<ref name='LIB:cgsc'/><br />
|<br />
est. P1 cotransduction: 27% <ref name='LIB:Nichols_linked_Tn'/><br />
<br />
Synonyms:zbi-29::Tn10 <br />
|-class='sortbottom'<br />
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.12069.G46a9b8057ab70&page=12069&pagename={{FULLPAGENAMEE}} edit table] || || ||<br />
|}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.G46a9b8057ab70--><br />
{{Gene_resources_help}}<br />
<protect><!--Gene_resources_notes--></protect><br />
===Notes===<br />
<br />
<br />
==Accessions in Other Databases==<br />
{{BacktoTop}}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.P46a9b8060f105--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|class = 'sortable' {{Prettytable}} id='129411' <br />
|- {{table_heading_style}}<br />
!Database!!Accession!!Notes<br />
|-<br />
|<br />
[http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]]) <br />
|<br />
[http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&object=EG10363 EcoCyc:EG10363] <br />
|<br />
<br />
|-<br />
|<br />
[http://www.ecoli-york.org EchoBASE] ([[EchoBASE|EcoliWiki Page]]) <br />
|<br />
[http://www.york.ac.uk/res/thomas/Gene.cfm?recordID=EB0358 EchoBASE:EB0358] <br />
|<br />
<br />
|-<br />
|<br />
[http://chase.ou.edu/oubcf/index.php EcoliGenExpDB] ([[EcoliGenExpDB|EcoliWiki Page]]) <br />
|<br />
[http://chase.ou.edu/macro/searchlink.php?bnum=b0757 EcoliGenExpDB:b0757] <br />
|<br />
<br />
|-<br />
|<br />
[http://BioCyc.org/ECOL199310/ ECOL199310CYC] ([[ECOL199310CYC|EcoliWiki Page]]) <br />
|<br />
[http://BioCyc.org/ECOL199310/new-image?object=C0833 ECOL199310CYC:C0833] <br />
|<br />
<br />
|-<br />
|<br />
[http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]]) <br />
|<br />
[http://ecogene.org/geneinfo.php?eg_id=EG10363 EcoGene:EG10363] <br />
|<br />
<br />
|-<br />
|<br />
[http://BioCyc.org/ECOO157/ ECOO157CYC] ([[ECOO157CYC|EcoliWiki Page]]) <br />
|<br />
[http://BioCyc.org/ECOO157/new-image?object=GALK ECOO157CYC:GALK] <br />
|<br />
<br />
|-<br />
|<br />
[http://cgsc.biology.yale.edu CGSC] ([[CGSC|EcoliWiki Page]]) <br />
|<br />
[http://cgsc.biology.yale.edu/cgi-bin/sybgw/cgsc/Site/723 CGSC:723] <br />
|<br />
<br />
|-class='sortbottom'<br />
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.12069.P46a9b8060f105&page=12069&pagename={{FULLPAGENAMEE}} edit table] || ||<br />
|}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.P46a9b8060f105--><br />
{{Gene_accessions_help}}<br />
<protect><!--Gene_accessions_notes--></protect><br />
===Notes===<br />
<br />
<br />
==Links==<br />
{{BacktoTop}}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.O46a6d54196e96--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|class = 'sortable' {{Prettytable}} id='96871' <br />
|- {{table_heading_style}}<br />
!Name!!URL!!Comments<br />
|-class='sortbottom'<br />
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.12069.O46a6d54196e96&page=12069&pagename={{FULLPAGENAMEE}} edit table] || ||<br />
|}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.O46a6d54196e96--><br />
{{Links_help}}<br />
<br />
<noinclude><protect><br />
==References==<br />
{{BacktoTop}}<br />
{{RefHelp}}<br />
<references/><br />
__NOTOC__<br />
</protect></noinclude><br />
===Categories===<br />
[[Category:Gene List:MG1655]]<br />
[[Category:Gene List:W3110]]<br />
[[Category:Genes in the Keio knockout collection]]<br />
[[Category:Genes in the ASKA clone collection]]</div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galK:Gene&diff=320055galK:Gene2007-11-11T16:07:57Z<p>Sburn: edited by Sburn via TableEdit</p>
<hr />
<div><!--<br />
***************************************************************************************************************************************************<br />
*<br />
* PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br />
* YOU'RE PROBABLY IN THE WRONG PLACE<br />
*<br />
*<br />
***************************************************************************************************************************************************<br />
-->{{#css:Suppresslinks.css}}<css>{{:Suppresslinks.css}}</css><br />
<noinclude>{{TabsTop}} <br />
{{Tab|Quickview|galK}}{{Tab On|Gene|galK}}{{Tab|Gene Product(s)|galK}}{{Tab|Expression|galK}}{{Tab|Evolution|galK}}{{Tab|On One Page|galK}}{{TabsBottom}}<br />
{|<br />
|- style="background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;" <br />
|{{Sub}}[[#Nomenclature |Nomenclature]]<br />
|{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br />
|{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br />
|{{Sub}}[[#Genetic Resources |Genetic Resources]]<br />
|{{Sub}}[[#Accessions in Other Databases |Accessions]]<br />
|{{Sub}}[[#Links |Links]]<br />
|{{Sub}}[[#References |References]]<br />
|{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br />
|}<br />
</noinclude><protect><br />
==Nomenclature==<br />
{{BacktoTop}}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.T46a9b80370c4a--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|{{Prettytable}}<br />
|-<br />
!{{table_heading_style}} |Standard name<br />
|<br />
''galK'' <br />
|-<br />
!{{table_heading_style}} |Mnemonic<br />
|<br />
<br />
|-<br />
!{{table_heading_style}} |Synonyms<br />
|<br />
''ECK0746, b0757, JW0740, galA''<ref name='LIB:Riley_2006'/><br />
|-<br />
|colspan='2'|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.12069.T46a9b80370c4a&page=12069&pagename={{FULLPAGENAMEE}} edit table]<br />
|}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.T46a9b80370c4a--><br />
{{Gene_nomenclature_help}}<br />
<!--Nomenclature_notes--></protect><br />
===Notes===<br />
<br />
<br />
==Location(s) and DNA Sequence==<br />
{{BacktoTop}}<br />
<protect><br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.Q46a9b803e87f8--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|class = 'sortable' {{Prettytable}} id='129407' <br />
|- {{table_heading_style}}<br />
!Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br />
|-<br />
|<br />
MG1655<br />
|<br />
16.99 minutes&nbsp;<br />
|<br />
MG1655: 789202..788054<br />{{GBrowseFigureByCoord|787054|790202|ecoli|MG1655}} <br />
|<br />
*[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG10363 EcoCyc]<br />
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli/?q=MG1655:787054..790202 GBrowse(MG1655)]<br />
<br />
|<br />
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli/?plugin=FastaDumper&name=MG1655:788054..789202&plugin_action=Go FASTA Dump]<br />
*[http://biocyc.org/ECOLI/sequence?object=EG10363 EcoCyc Sequence Dump] <br />
|-<br />
|<br />
W3110<br />
|<br />
&nbsp;<br />
|<br />
W3110: 790401..789253<br />{{GBrowseFigureByCoord|788253|791401|ecoli_W3110|W3110}} <br />
|<br />
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli_W3110/?q=W3110:788253..791401 GBrowse(W3110)] <br />
|<br />
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli_W3110/?plugin=FastaDumper&name=W3110:789253..790401&plugin_action=Go FASTA Dump] <br />
|-class='sortbottom'<br />
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.12069.Q46a9b803e87f8&page=12069&pagename={{FULLPAGENAMEE}} edit table] || || || ||<br />
|}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.Q46a9b803e87f8--><br />
{{Gene_location_help}}<br />
<!--Location_notes--></protect><br />
===Notes===<br />
<br />
<br />
==Sequence Features==<br />
{{BacktoTop}}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.M46a9b804919fb--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|class = 'sortable' {{Prettytable}} id='129408' <br />
|- {{table_heading_style}}<br />
!Feature type!!Location!!Description<br />
|-class='sortbottom'<br />
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.12069.M46a9b804919fb&page=12069&pagename={{FULLPAGENAMEE}} edit table] || ||<br />
|}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.M46a9b804919fb--><br />
{{Gene_sequence_features_help}}<br />
<protect><!--Sequence_notes--></protect><br />
====Notes====<br />
<br />
<br />
==Alleles and Phenotypes==<br />
{{BacktoTop}}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.T46a9b804d196d--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|class = 'sortable' {{Prettytable}} id='129409' <br />
|- {{table_heading_style}}<br />
!Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br />
|-<br />
|<br />
&Delta;galK (Keio:JW0740)<br />
|<br />
deletion<br />
|<br />
deletion<br />
|<br />
<br />
|<br />
<br />
|<br />
[[PMID:16738554]]<ref name=PMID:16738554/><br />
|<br />
[http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]<br>[http://cgsc2.biology.yale.edu/Strain.php?ID=107084 CGSC8803]<ref name='LIB:cgsc'/> <br />
|<br />
<br />
|-<br />
|<br />
ΔgalK2<br />
|<br />
E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
|<br />
<br />
|<br />
<br />
|<br />
Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
|<br />
[[PMID:17247607]]<ref name=PMID:17247607/> [[PMID:13390972]]<ref name=PMID:13390972/><br />
|<br />
<br />
|<br />
<br />
|-class='sortbottom'<br />
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.12069.T46a9b804d196d&page=12069&pagename={{FULLPAGENAMEE}} edit table] || || || || || || ||<br />
|}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.T46a9b804d196d--><br />
{{Gene_alleles_help}}<br />
<protect><!--Alleles_notes--></protect><br />
===Notes===<br />
<br />
<br />
==Genetic Resources==<br />
{{BacktoTop}}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.G46a9b8057ab70--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|class = 'sortable' {{Prettytable}} id='129410' <br />
|- {{table_heading_style}}<br />
!Resource!!Resource Type!!Source!!Notes/Reference<br />
|-<br />
|<br />
JW0740<br />
|<br />
Plasmid clone<br />
|<br />
[http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br />
|<br />
[[PMID:16769691]]<ref name=PMID:16769691/><br />
<br />
Status:Clone OK<br />
<br />
Primer 1:GCCAGTCTGAAAGAAAAAACACA<br />
<br />
Primer 2:CCGCACTGTCCTGCTCCTTGTGA <br />
|-<br />
|<br />
[[nadA:Gene|nadA57::Tn10]]<br />
|<br />
Linked marker<br />
|<br />
CAG12147 = [http://cgsc2.biology.yale.edu/Strain.php?ID=38017 CGSC7351]<ref name='LIB:cgsc'/><br />
|<br />
est. P1 cotransduction: 75% <ref name='LIB:Nichols_linked_Tn'/> <br />
|-<br />
|<br />
zbh-29::Tn10<br />
|<br />
Linked marker<br />
|<br />
CAG18493 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39400 CGSC7353]<ref name='LIB:cgsc'/><br />
|<br />
est. P1 cotransduction: 27% <ref name='LIB:Nichols_linked_Tn'/><br />
<br />
Synonyms:zbi-29::Tn10 <br />
|-class='sortbottom'<br />
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.12069.G46a9b8057ab70&page=12069&pagename={{FULLPAGENAMEE}} edit table] || || ||<br />
|}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.G46a9b8057ab70--><br />
{{Gene_resources_help}}<br />
<protect><!--Gene_resources_notes--></protect><br />
===Notes===<br />
<br />
<br />
==Accessions in Other Databases==<br />
{{BacktoTop}}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.P46a9b8060f105--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|class = 'sortable' {{Prettytable}} id='129411' <br />
|- {{table_heading_style}}<br />
!Database!!Accession!!Notes<br />
|-<br />
|<br />
[http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]]) <br />
|<br />
[http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&object=EG10363 EcoCyc:EG10363] <br />
|<br />
<br />
|-<br />
|<br />
[http://www.ecoli-york.org EchoBASE] ([[EchoBASE|EcoliWiki Page]]) <br />
|<br />
[http://www.york.ac.uk/res/thomas/Gene.cfm?recordID=EB0358 EchoBASE:EB0358] <br />
|<br />
<br />
|-<br />
|<br />
[http://chase.ou.edu/oubcf/index.php EcoliGenExpDB] ([[EcoliGenExpDB|EcoliWiki Page]]) <br />
|<br />
[http://chase.ou.edu/macro/searchlink.php?bnum=b0757 EcoliGenExpDB:b0757] <br />
|<br />
<br />
|-<br />
|<br />
[http://BioCyc.org/ECOL199310/ ECOL199310CYC] ([[ECOL199310CYC|EcoliWiki Page]]) <br />
|<br />
[http://BioCyc.org/ECOL199310/new-image?object=C0833 ECOL199310CYC:C0833] <br />
|<br />
<br />
|-<br />
|<br />
[http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]]) <br />
|<br />
[http://ecogene.org/geneinfo.php?eg_id=EG10363 EcoGene:EG10363] <br />
|<br />
<br />
|-<br />
|<br />
[http://BioCyc.org/ECOO157/ ECOO157CYC] ([[ECOO157CYC|EcoliWiki Page]]) <br />
|<br />
[http://BioCyc.org/ECOO157/new-image?object=GALK ECOO157CYC:GALK] <br />
|<br />
<br />
|-<br />
|<br />
[http://cgsc.biology.yale.edu CGSC] ([[CGSC|EcoliWiki Page]]) <br />
|<br />
[http://cgsc.biology.yale.edu/cgi-bin/sybgw/cgsc/Site/723 CGSC:723] <br />
|<br />
<br />
|-class='sortbottom'<br />
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.12069.P46a9b8060f105&page=12069&pagename={{FULLPAGENAMEE}} edit table] || ||<br />
|}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.P46a9b8060f105--><br />
{{Gene_accessions_help}}<br />
<protect><!--Gene_accessions_notes--></protect><br />
===Notes===<br />
<br />
<br />
==Links==<br />
{{BacktoTop}}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.O46a6d54196e96--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|class = 'sortable' {{Prettytable}} id='96871' <br />
|- {{table_heading_style}}<br />
!Name!!URL!!Comments<br />
|-class='sortbottom'<br />
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.12069.O46a6d54196e96&page=12069&pagename={{FULLPAGENAMEE}} edit table] || ||<br />
|}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.12069.O46a6d54196e96--><br />
{{Links_help}}<br />
<br />
<noinclude><protect><br />
==References==<br />
{{BacktoTop}}<br />
{{RefHelp}}<br />
<references/><br />
__NOTOC__<br />
</protect></noinclude><br />
===Categories===<br />
[[Category:Gene List:MG1655]]<br />
[[Category:Gene List:W3110]]<br />
[[Category:Genes in the Keio knockout collection]]<br />
[[Category:Genes in the ASKA clone collection]]</div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=319981galk22007-11-08T20:48:16Z<p>Sburn: </p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet.<br />
<br />
<br />
===References===<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=319965galk22007-11-08T15:54:52Z<p>Sburn: </p>
<hr />
<div>===Notes===<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet.<br />
<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=dcm:Quickview&diff=319964dcm:Quickview2007-11-08T15:54:17Z<p>Sburn: /* Notes */</p>
<hr />
<div><!--<br />
***************************************************************************************************************************************************<br />
*<br />
*<br />
* PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br />
* YOU'RE PROBABLY IN THE WRONG PLACE<br />
*<br />
*<br />
***************************************************************************************************************************************************<br />
-->{{#css:Suppresslinks.css}}<css>{{:Suppresslinks.css}}</css><br />
<noinclude>{{TabsTop}} <br />
{{Tab On|Quickview|dcm}}{{Tab|Gene|dcm}}{{Tab|Gene Product(s)|dcm}}{{Tab|Expression|dcm}}{{Tab|Evolution|dcm}}{{Tab|On One Page|dcm}}{{TabsBottom}}<br />
{|<br />
|- style="background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;" <br />
|{{Sub}}[[#References| References]]<br />
|{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br />
|}<br />
</noinclude><br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.5679.O46a99efd38234--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|{{Prettytable}}<br />
|-<br />
!{{table_heading_style}} |Gene Name<br />
|<br />
[[dcm:Gene|''dcm]]'' (synonyms: ''ECK1959, b1961, JW1944, mec'')<ref name='LIB:Riley_2006'/><br />
|-<br />
!{{table_heading_style}} |Product(s) <br />
|<br />
[[dcm:Gene_Product(s)|Dcm product]]<ref name='LIB:Riley_2006'/>: DNA cytosine methylase product, B1961 product, Mec product<br />
|-<br />
!{{table_heading_style}} |Description <br />
|<br />
DNA cytosine methylase<ref name='LIB:EcoCyc10.6'/><ref name='LIB:EcoCyc11.1'/> <br />
<br />
|-<br />
!{{table_heading_style}} |Knock-Out Phenotype <br />
|<br />
<br />
|-<br />
!{{table_heading_style}} |Regulation/Expression <br />
|<br />
transcription unit(s): [[:Category:Txn_unit:dcm-vsr|dcm-vsr]]<ref name='LIB:EcoCyc10.6'/> <br />
|-<br />
!{{table_heading_style}} |Regulation/Activity<br />
|<br />
<br />
|-<br />
|colspan='2'|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.5679.O46a99efd38234&page=5679&pagename={{FULLPAGENAMEE}} edit table]<br />
|}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.5679.O46a99efd38234--><br />
{{Quickview_table_help}}<br />
<protect><!--Quickview_notes--></protect><br />
===Notes===<br />
<br />
'''Method of Mutagenesis:''' Log-phase cultures of strain GM 1 were treated with Alkylating agent (N-methyl-N-nitro-nitrosoguanidine)<ref name=PMID:4576399/> <br />
<br />
<br />
'''Phenotype Observed:''' Mutants were tested for S-adenosylmethionine methyltransferase activity by measuring the levels of DNA-cytosine (S-adenosylmethionine and DNA-adenine. The mutants showed reduced or absent activity. Also, deficient in methylcytosine in DNA. <ref name=PMID:4576399/> <br />
<br />
<br />
{{BacktoTop}}<br />
<br />
<br />
<noinclude><br />
<br />
==References==<br />
{{BacktoTop}}<br />
{{RefHelp}}<br />
<references/><br />
</noinclude></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=319963galk22007-11-08T15:45:44Z<p>Sburn: </p>
<hr />
<div>'''Notes:'''<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet.<br />
<br />
<br />
<br />
<references/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=319962galk22007-11-08T15:43:01Z<p>Sburn: </p>
<hr />
<div>'''Notes:'''<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
<br />
<br />
<br />
'''Notice:''' no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet.<br />
<br />
<br />
<br />
Refrences:</div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=319961galk22007-11-08T15:42:24Z<p>Sburn: </p>
<hr />
<div>'''Notes:'''<br />
<br />
<br />
'''Mutagenesis:''' E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
<br />
<br />
'''Phenotype:''' Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/><br />
<br />
Notice no direct refrence to the isolation of galactose negative mutants of galactokinase 2. Direct publication not identified for galactokinase 2. This shows the isolation of galactokinase mutants, but it should have been found in similar manner. Galk2 mutation is a newer discovery and not quite clear yet.</div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=319960galk22007-11-08T15:40:27Z<p>Sburn: </p>
<hr />
<div>Notes:<br />
<br />
<br />
Mutagenesis: E coli bacteria was treated with UV radiation to induce mutation in galactose pathway <ref name=PMID:17247607/> <br />
<br />
Phenotype: Galactose is broken down through α-galactose-1-phosphate(GAL-1-P), uridine diphosphogalactose (UDPGal), and uridine diphosphoglucose (UDPG). Three enzymes are used to convert galactose to glycolytic intermediate. Under incubation, galactose mutants were given galactose and ATP and researchers measured the production of galactose-1-phosphate to determine galactokinase activity. Galactose negative mutants showed no galactokinase activity and therefore no production of galacose-1-phosphate. <ref name=PMID:13390972/></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=galk2&diff=319954galk22007-11-08T05:43:16Z<p>Sburn: New page: Notes: Mutagenesis: Phenotype:</p>
<hr />
<div>Notes:<br />
<br />
<br />
Mutagenesis:<br />
<br />
Phenotype:</div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=overview&diff=319953overview2007-11-08T05:04:39Z<p>Sburn: </p>
<hr />
<div>==About==<br />
<br />
<br />
==References==<br />
<references/><br />
{{{CATEGORIES}}}</div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=overview&diff=319952overview2007-11-08T05:03:24Z<p>Sburn: New page: ==About== galk2 ==References== <references/> {{{CATEGORIES}}}</p>
<hr />
<div>==About==<br />
galk2<br />
<br />
==References==<br />
<references/><br />
{{{CATEGORIES}}}</div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=dcm:Quickview&diff=319951dcm:Quickview2007-11-08T04:55:40Z<p>Sburn: /* Notes */</p>
<hr />
<div><!--<br />
***************************************************************************************************************************************************<br />
*<br />
*<br />
* PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br />
* YOU'RE PROBABLY IN THE WRONG PLACE<br />
*<br />
*<br />
***************************************************************************************************************************************************<br />
-->{{#css:Suppresslinks.css}}<css>{{:Suppresslinks.css}}</css><br />
<noinclude>{{TabsTop}} <br />
{{Tab On|Quickview|dcm}}{{Tab|Gene|dcm}}{{Tab|Gene Product(s)|dcm}}{{Tab|Expression|dcm}}{{Tab|Evolution|dcm}}{{Tab|On One Page|dcm}}{{TabsBottom}}<br />
{|<br />
|- style="background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;" <br />
|{{Sub}}[[#References| References]]<br />
|{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br />
|}<br />
</noinclude><br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.5679.O46a99efd38234--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|{{Prettytable}}<br />
|-<br />
!{{table_heading_style}} |Gene Name<br />
|<br />
[[dcm:Gene|''dcm]]'' (synonyms: ''ECK1959, b1961, JW1944, mec'')<ref name='LIB:Riley_2006'/><br />
|-<br />
!{{table_heading_style}} |Product(s) <br />
|<br />
[[dcm:Gene_Product(s)|Dcm product]]<ref name='LIB:Riley_2006'/>: DNA cytosine methylase product, B1961 product, Mec product<br />
|-<br />
!{{table_heading_style}} |Description <br />
|<br />
DNA cytosine methylase<ref name='LIB:EcoCyc10.6'/><ref name='LIB:EcoCyc11.1'/> <br />
<br />
|-<br />
!{{table_heading_style}} |Knock-Out Phenotype <br />
|<br />
<br />
|-<br />
!{{table_heading_style}} |Regulation/Expression <br />
|<br />
transcription unit(s): [[:Category:Txn_unit:dcm-vsr|dcm-vsr]]<ref name='LIB:EcoCyc10.6'/> <br />
|-<br />
!{{table_heading_style}} |Regulation/Activity<br />
|<br />
<br />
|-<br />
|colspan='2'|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.5679.O46a99efd38234&page=5679&pagename={{FULLPAGENAMEE}} edit table]<br />
|}<br />
<!--box uid=421aa90e079fa326b6494f812ad13e79.5679.O46a99efd38234--><br />
{{Quickview_table_help}}<br />
<protect><!--Quickview_notes--></protect><br />
===Notes===<br />
<br />
Method of Mutagenesis: Alkylating agent (N-methyl-N-nitro-nitrosoguanidine)<ref name=PMID:4576399/> <br />
<br />
<br />
Phenotype Observed: reduced or absent activity, phenotypically deficient in methylcytosine in DNA <ref name=PMID:4576399/> <br />
<br />
<br />
{{BacktoTop}}<br />
<br />
<br />
<noinclude><br />
<br />
==References==<br />
{{BacktoTop}}<br />
{{RefHelp}}<br />
<references/><br />
</noinclude></div>Sburnhttps://ecoliwiki.org/colipedia/index.php?title=Sandbox&diff=319950Sandbox2007-11-08T04:45:16Z<p>Sburn: </p>
<hr />
<div>'''bold'''<br />
<br />
<br />
<br />
<br />
''Ecoliwiki'' is '''good.'''<br />
[[cynR]]<br />
<br />
I am trying to see how your ref system works... <ref name=PMID:8529872/>, no really! <ref name=PMID:11791232/>. Here is another sentence <ref name=PMID:2614845/>.<br />
<br />
----<br />
<br />
<references/><br />
<br />
<ref name=PMID:4576399/> <br />
<br />
<br />
<protect><!--box uid=63ce1649aab8b3180235b0af7618f667.2.X46d4749030581--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|class = 'sortable' {{Prettytable}} id='220559' <br />
|-<br />
!Here is a heading!!And another!!and another<br />
|-class='sortbottom'<br />
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=63ce1649aab8b3180235b0af7618f667.2.X46d4749030581&page=2&pagename={{FULLPAGENAMEE}} edit table] || ||<br />
|}<br />
<!--box uid=63ce1649aab8b3180235b0af7618f667.2.X46d4749030581--></protect><br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<br />
<protect><!--box uid=63ce1649aab8b3180235b0af7618f667.2.R46d8443aef9da--><br />
<!--<br />
******************************************************************************************<br />
*<br />
* ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. **<br />
*<br />
****************************************************************************************** --><br />
{|class = 'sortable' {{Prettytable}} id='220574' <br />
|-<br />
!Feature!!Coordinates!!Source<br />
|-class='sortbottom'<br />
|[{{SERVER}}/colipedia/index.php?title=Special:TableEdit&id=63ce1649aab8b3180235b0af7618f667.2.R46d8443aef9da&page=2&pagename={{FULLPAGENAMEE}} edit table] || ||<br />
|}<br />
<!--box uid=63ce1649aab8b3180235b0af7618f667.2.R46d8443aef9da--></protect></div>Sburn