https://ecoliwiki.org/colipedia/api.php?action=feedcontributions&feedformat=atom&user=Ohs EcoliWiki - User contributions [en] 2026-11-02T21:46:03Z User contributions MediaWiki 1.43.11 https://ecoliwiki.org/colipedia/index.php?title=gyrA:Gene&diff=1373737 gyrA:Gene 2012-11-03T18:58:33Z <p>Ohs: Table edited by Ohs via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|gyrA}}{{Tab On|Gene|gyrA}}{{Tab|Gene Product(s)|gyrA}}{{Tab|Expression|gyrA}}{{Tab|Evolution|gyrA}}{{Tab|On One Page|gyrA}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.R46a9d91c5e712--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;R46a9d91c5e712&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''gyrA''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Gyrase<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK2223, b2231, JW2225, hisW, nalA, parD, nfxA, norA''&lt;ref name='LIB:Riley_2006'/&gt;, norA''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15021.R46a9d91c5e712&amp;page=15021&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.R46a9d91c5e712--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.C46a9d91cdc05f--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;C46a9d91cdc05f&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 50.32 minutes&amp;nbsp;<br /> |<br /> MG1655: 2337442..2334815&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:2334815..2337442<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG10423 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|2333815|2338442|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|2334815|2337442|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG10423 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 2286120..2283493&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:2283493..2286120<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|2283493|2286120|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|2283493|2286120|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 2220620..2223247&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:2220620..2223247<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|2220620|2223247|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|2220620|2223247|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 2344090..2341463&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:2341463..2344090<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|2340463|2345090|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|2341463|2344090|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 2428430..2425803&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:2425803..2428430<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|2420549|2433684|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|2420549|2433684|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15021.C46a9d91cdc05f&amp;page=15021&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.C46a9d91cdc05f--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.G46a9d91d92aa0--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;G46a9d91d92aa0&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> |- <br /> |<br /> Coding Start (SO:0000323)<br /> |<br /> [[MG1655]]<br /> |<br /> 2334818<br /> |<br /> Edman degradation<br /> |<br /> PMID:3029031&lt;br /&gt;<br /> |<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15021.G46a9d91d92aa0&amp;page=15021&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.G46a9d91d92aa0--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.M46a9d91dd79d1--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;M46a9d91dd79d1&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> gyrAA67S<br /> |<br /> <br /> |<br /> A67S<br /> |<br /> <br /> |<br /> (in PPA-10; quinolone-resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAG81C<br /> |<br /> <br /> |<br /> G81C<br /> |<br /> <br /> |<br /> (in NAL-97; quinolone-resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAD678E<br /> |<br /> <br /> |<br /> D678E<br /> |<br /> <br /> |<br /> (in strain: 227)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAI798IMMI<br /> |<br /> <br /> |<br /> I798IMMI<br /> |<br /> <br /> |<br /> (in KL-16; quinolone- resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAA828S<br /> |<br /> <br /> |<br /> A828S<br /> |<br /> <br /> |<br /> (in strain: 227)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAS83A<br /> |<br /> <br /> |<br /> S83A<br /> |<br /> <br /> |<br /> Resistant to fluoroquinolones<br /> |<br /> <br /> |<br /> <br /> |<br /> seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAQ106R<br /> |<br /> <br /> |<br /> Q106R<br /> |<br /> <br /> |<br /> Resistant to fluoroquinolones<br /> |<br /> <br /> |<br /> <br /> |<br /> seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAS83W<br /> |<br /> <br /> |<br /> S83W<br /> |<br /> <br /> |<br /> (in PPA-18 and strain 227; quinolone-resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAA84P<br /> |<br /> <br /> |<br /> A84P<br /> |<br /> <br /> |<br /> (in PPA-05; quinolone-resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAD87N<br /> |<br /> <br /> |<br /> D87N<br /> |<br /> <br /> |<br /> (in NAL-113 and KL-16; quinolone- resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAQ106H<br /> |<br /> <br /> |<br /> Q106H<br /> |<br /> <br /> |<br /> (in NAL-89; quinolone-resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAD87V<br /> |<br /> <br /> |<br /> D87V<br /> |<br /> <br /> |<br /> (in strain: 202; quinolone- resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAS83L<br /> |<br /> <br /> |<br /> S83L<br /> |<br /> <br /> |<br /> (in NAL-51, NAL-112, NAL-118 and NAL-119; quinolone-resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> ''gyrA98''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:4735|CGSC:4735]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA20''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:4693|CGSC:4693]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA12''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:5833|CGSC:5833]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA26''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:6591|CGSC:6591]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA39''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:6657|CGSC:6657]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA96''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:6781|CGSC:6781]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA91''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:6799|CGSC:6799]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA93''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:7183|CGSC:7183]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA216''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:7227|CGSC:7227]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA220''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:7261|CGSC:7261]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA218''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:7270|CGSC:7270]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA13''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:8316|CGSC:8316]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA19''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:8423|CGSC:8423]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA111''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:8506|CGSC:8506]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA261''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:8753|CGSC:8753]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA90''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:9163|CGSC:9163]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA99''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:9220|CGSC:9220]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA49''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:9554|CGSC:9554]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA217''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:9588|CGSC:9588]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA223''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:9628|CGSC:9628]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA219''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:9719|CGSC:9719]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA271''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:10266|CGSC:10266]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA260''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:10312|CGSC:10312]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA270''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:10450|CGSC:10450]]<br /> |<br /> <br /> |- <br /> |<br /> ''[gyrA43]''(ts)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> temperature sensitive<br /> |<br /> <br /> |<br /> [[cgscmutation:10853|CGSC:10853]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA25''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:10898|CGSC:10898]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA21''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:11844|CGSC:11844]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA222''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:12272|CGSC:12272]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA29''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:12928|CGSC:12928]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA17''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:14039|CGSC:14039]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA42''(ts)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> temperature sensitive<br /> |<br /> <br /> |<br /> [[cgscmutation:17046|CGSC:17046]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA283''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:17056|CGSC:17056]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA44''(ts)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> temperature sensitive<br /> |<br /> <br /> |<br /> [[cgscmutation:17109|CGSC:17109]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA37''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:19366|CGSC:19366]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA329''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:23665|CGSC:23665]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA284''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:26543|CGSC:26543]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA900''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:73380|CGSC:73380]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA586''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:90278|CGSC:90278]]<br /> |<br /> <br /> |- <br /> |<br /> gyrA(Am) from OV6<br /> |<br /> <br /> |<br /> <br /> |<br /> Growth Phenotype<br /> |<br /> at 42C the separation of DNA into nucleoids and division localization are both disturbed but cells have continued growth and DNA replication <br /> production of cells, and normal sized cells are all produced at 42C<br /> |<br /> PMID:330757<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> ''gyrA43(TS)''<br /> |<br /> <br /> |<br /> <br /> |<br /> Resistant to<br /> |<br /> Resistant to Nalidixic Acid at the permissive temperature 32 C. <br /> |<br /> PMID:3025879<br /> |<br /> Strain: KRF949<br /> <br /> Parental Strain: [http://cgsc.biology.yale.edu/Strain.php?ID=10860 CGSC KNK43]<br /> <br /> <br /> [http://cgsc.biology.yale.edu/Mutation.php?ID=10853 CGSC] of allele, not strain.<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA43''<br /> |<br /> <br /> |<br /> <br /> |<br /> Resistant to<br /> |<br /> Resistant to Triazolealanine.<br /> |<br /> PMID:3025879<br /> |<br /> Strain: KRE449<br /> <br /> Parental:[http://cgsc.biology.yale.edu/Strain.php?ID=10860 CGSC KNK453]<br /> |<br /> Results on table 4. <br /> |- <br /> |<br /> nalA mutation in MH5<br /> |<br /> <br /> |<br /> <br /> |<br /> Resistant to<br /> |<br /> resistance to nalidixic acid <br /> |<br /> PMID:4895844<br /> |<br /> <br /> |<br /> similar strain: MH7 <br /> resistant at 40ug nal per ml, sensitive at 60ug nal per ml <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15021.M46a9d91dd79d1&amp;page=15021&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.M46a9d91dd79d1--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> A Latin American study found that the ''gyrA'' single-point mutation has caused ''E. coli'' to become resistant to Fluoroquinolones, or antimicrobial drugs. This has resulted in an increase in the number of urinary tract infections. &lt;ref name='PMID:10744370'/&gt;<br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.15021.G4e04bcc82efc8--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;G4e04bcc82efc8&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.15021.G4e04bcc82efc8&amp;page=15021&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.15021.G4e04bcc82efc8--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.B46a9d91e8e70c--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;B46a9d91e8e70c&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW2225<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCAGCGACCTTGCGAGAGAAAT<br /> <br /> Primer 2:CCTTCTTCTTCTGGCTCGTCGTC <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:E13A5|E13A5]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=376 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:2E8|2E8]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=377 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[atoS:Gene|atoS298::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12177 gyrA+ = [http://cgsc2.biology.yale.edu/Strain.php?ID=44154 CGSC7525]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 59% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zeh-298::Tn10, zej-298::Tn10 nnnThe original CAG12177 was NalR. This is a NalS derivative constructed by S. McAteer (CGSC). <br /> |- <br /> |<br /> [[yfaL:Gene|zfa-723::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12178 gyrA+ = [http://cgsc2.biology.yale.edu/Strain.php?ID=44155 CGSC7526]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 76% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zei-723::Tn10, zfa-723::Tn10 nnnThe original CAG12178 was NalR. This is a NalS derivative constructed by S. McAteer (CGSC). <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15021.B46a9d91e8e70c&amp;page=15021&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.B46a9d91e8e70c--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.C46a9d91f2e5e3--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;C46a9d91f2e5e3&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG10423 ECOCYC:EG10423]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG10423 EcoGene:EG10423]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=946614 GeneID:946614]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15021.C46a9d91f2e5e3&amp;page=15021&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.C46a9d91f2e5e3--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.A46a6f64ab76e7--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;A46a6f64ab76e7&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15021.A46a6f64ab76e7&amp;page=15021&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.A46a6f64ab76e7--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes not in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:gyr genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Ohs https://ecoliwiki.org/colipedia/index.php?title=gyrA:Gene&diff=1373734 gyrA:Gene 2012-11-03T18:56:35Z <p>Ohs: Table edited by Ohs via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|gyrA}}{{Tab On|Gene|gyrA}}{{Tab|Gene Product(s)|gyrA}}{{Tab|Expression|gyrA}}{{Tab|Evolution|gyrA}}{{Tab|On One Page|gyrA}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.R46a9d91c5e712--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;R46a9d91c5e712&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''gyrA''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Gyrase<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK2223, b2231, JW2225, hisW, nalA, parD, nfxA, norA''&lt;ref name='LIB:Riley_2006'/&gt;, norA''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15021.R46a9d91c5e712&amp;page=15021&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.R46a9d91c5e712--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.C46a9d91cdc05f--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;C46a9d91cdc05f&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 50.32 minutes&amp;nbsp;<br /> |<br /> MG1655: 2337442..2334815&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:2334815..2337442<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG10423 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|2333815|2338442|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|2334815|2337442|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG10423 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 2286120..2283493&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:2283493..2286120<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|2283493|2286120|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|2283493|2286120|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 2220620..2223247&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:2220620..2223247<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|2220620|2223247|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|2220620|2223247|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 2344090..2341463&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:2341463..2344090<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|2340463|2345090|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|2341463|2344090|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 2428430..2425803&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:2425803..2428430<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|2420549|2433684|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|2420549|2433684|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15021.C46a9d91cdc05f&amp;page=15021&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.C46a9d91cdc05f--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.G46a9d91d92aa0--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;G46a9d91d92aa0&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> |- <br /> |<br /> Coding Start (SO:0000323)<br /> |<br /> [[MG1655]]<br /> |<br /> 2334818<br /> |<br /> Edman degradation<br /> |<br /> PMID:3029031&lt;br /&gt;<br /> |<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15021.G46a9d91d92aa0&amp;page=15021&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.G46a9d91d92aa0--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.M46a9d91dd79d1--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;M46a9d91dd79d1&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> gyrAA67S<br /> |<br /> <br /> |<br /> A67S<br /> |<br /> <br /> |<br /> (in PPA-10; quinolone-resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAG81C<br /> |<br /> <br /> |<br /> G81C<br /> |<br /> <br /> |<br /> (in NAL-97; quinolone-resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAD678E<br /> |<br /> <br /> |<br /> D678E<br /> |<br /> <br /> |<br /> (in strain: 227)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAI798IMMI<br /> |<br /> <br /> |<br /> I798IMMI<br /> |<br /> <br /> |<br /> (in KL-16; quinolone- resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAA828S<br /> |<br /> <br /> |<br /> A828S<br /> |<br /> <br /> |<br /> (in strain: 227)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAS83A<br /> |<br /> <br /> |<br /> S83A<br /> |<br /> <br /> |<br /> Resistant to fluoroquinolones<br /> |<br /> <br /> |<br /> <br /> |<br /> seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAQ106R<br /> |<br /> <br /> |<br /> Q106R<br /> |<br /> <br /> |<br /> Resistant to fluoroquinolones<br /> |<br /> <br /> |<br /> <br /> |<br /> seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAS83W<br /> |<br /> <br /> |<br /> S83W<br /> |<br /> <br /> |<br /> (in PPA-18 and strain 227; quinolone-resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAA84P<br /> |<br /> <br /> |<br /> A84P<br /> |<br /> <br /> |<br /> (in PPA-05; quinolone-resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAD87N<br /> |<br /> <br /> |<br /> D87N<br /> |<br /> <br /> |<br /> (in NAL-113 and KL-16; quinolone- resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAQ106H<br /> |<br /> <br /> |<br /> Q106H<br /> |<br /> <br /> |<br /> (in NAL-89; quinolone-resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAD87V<br /> |<br /> <br /> |<br /> D87V<br /> |<br /> <br /> |<br /> (in strain: 202; quinolone- resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> gyrAS83L<br /> |<br /> <br /> |<br /> S83L<br /> |<br /> <br /> |<br /> (in NAL-51, NAL-112, NAL-118 and NAL-119; quinolone-resistant)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0AES4 UniProt:P0AES4] <br /> |- <br /> |<br /> ''gyrA98''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:4735|CGSC:4735]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA20''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:4693|CGSC:4693]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA12''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:5833|CGSC:5833]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA26''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:6591|CGSC:6591]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA39''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:6657|CGSC:6657]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA96''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:6781|CGSC:6781]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA91''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:6799|CGSC:6799]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA93''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:7183|CGSC:7183]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA216''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:7227|CGSC:7227]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA220''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:7261|CGSC:7261]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA218''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:7270|CGSC:7270]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA13''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:8316|CGSC:8316]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA19''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:8423|CGSC:8423]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA111''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:8506|CGSC:8506]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA261''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:8753|CGSC:8753]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA90''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:9163|CGSC:9163]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA99''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:9220|CGSC:9220]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA49''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:9554|CGSC:9554]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA217''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:9588|CGSC:9588]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA223''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:9628|CGSC:9628]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA219''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:9719|CGSC:9719]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA271''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:10266|CGSC:10266]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA260''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:10312|CGSC:10312]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA270''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:10450|CGSC:10450]]<br /> |<br /> <br /> |- <br /> |<br /> ''[gyrA43]''(ts)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> temperature sensitive<br /> |<br /> <br /> |<br /> [[cgscmutation:10853|CGSC:10853]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA25''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:10898|CGSC:10898]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA21''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:11844|CGSC:11844]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA222''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:12272|CGSC:12272]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA29''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:12928|CGSC:12928]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA17''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:14039|CGSC:14039]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA42''(ts)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> temperature sensitive<br /> |<br /> <br /> |<br /> [[cgscmutation:17046|CGSC:17046]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA283''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:17056|CGSC:17056]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA44''(ts)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> temperature sensitive<br /> |<br /> <br /> |<br /> [[cgscmutation:17109|CGSC:17109]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA37''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:19366|CGSC:19366]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA329''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:23665|CGSC:23665]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA284''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:26543|CGSC:26543]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA900''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:73380|CGSC:73380]]<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA586''(NalR)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> nalidixic acid resistant<br /> |<br /> <br /> |<br /> [[cgscmutation:90278|CGSC:90278]]<br /> |<br /> <br /> |- <br /> |<br /> gyrA(Am) from OV6<br /> |<br /> <br /> |<br /> <br /> |<br /> Growth Phenotype<br /> |<br /> at 42C the separation of DNA into nucleoids and division localization are both disturbed but cells have continued growth and DNA replication <br /> production of cells, and normal sized cells are all produced at 42C<br /> |<br /> PMID:330757<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> ''gyrA43(TS)''<br /> |<br /> <br /> |<br /> <br /> |<br /> Resistant to<br /> |<br /> Resistant to Nalidixic Acid at the permissive temperature 32 C. <br /> |<br /> PMID:3025879<br /> |<br /> Strain: KRF949<br /> <br /> Parental Strain: [http://cgsc.biology.yale.edu/Strain.php?ID=10860 CGSC KNK43]<br /> <br /> <br /> [http://cgsc.biology.yale.edu/Mutation.php?ID=10853 CGSC] of allele, not strain.<br /> |<br /> <br /> |- <br /> |<br /> ''gyrA43''<br /> |<br /> <br /> |<br /> <br /> |<br /> Resistant to<br /> |<br /> Resistant to Triazolealanine.<br /> |<br /> PMID:3025879<br /> |<br /> Strain: KRE449<br /> <br /> Parental:[http://cgsc.biology.yale.edu/Strain.php?ID=10860 CGSC KNK453]<br /> |<br /> Results on table 4. <br /> |- <br /> |<br /> nalAMH5<br /> |<br /> <br /> |<br /> <br /> |<br /> Resistant to<br /> |<br /> resistance to nalidixic acid at 40ug nal per ml, sensitive at 60ug nal per ml<br /> |<br /> PMID:4895844<br /> |<br /> <br /> |<br /> similar strain: MH7 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15021.M46a9d91dd79d1&amp;page=15021&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.M46a9d91dd79d1--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> A Latin American study found that the ''gyrA'' single-point mutation has caused ''E. coli'' to become resistant to Fluoroquinolones, or antimicrobial drugs. This has resulted in an increase in the number of urinary tract infections. &lt;ref name='PMID:10744370'/&gt;<br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.15021.G4e04bcc82efc8--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;G4e04bcc82efc8&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.15021.G4e04bcc82efc8&amp;page=15021&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.15021.G4e04bcc82efc8--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.B46a9d91e8e70c--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;B46a9d91e8e70c&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW2225<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCAGCGACCTTGCGAGAGAAAT<br /> <br /> Primer 2:CCTTCTTCTTCTGGCTCGTCGTC <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:E13A5|E13A5]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=376 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:2E8|2E8]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=377 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[atoS:Gene|atoS298::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12177 gyrA+ = [http://cgsc2.biology.yale.edu/Strain.php?ID=44154 CGSC7525]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 59% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zeh-298::Tn10, zej-298::Tn10 nnnThe original CAG12177 was NalR. This is a NalS derivative constructed by S. McAteer (CGSC). <br /> |- <br /> |<br /> [[yfaL:Gene|zfa-723::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12178 gyrA+ = [http://cgsc2.biology.yale.edu/Strain.php?ID=44155 CGSC7526]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 76% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zei-723::Tn10, zfa-723::Tn10 nnnThe original CAG12178 was NalR. This is a NalS derivative constructed by S. McAteer (CGSC). <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15021.B46a9d91e8e70c&amp;page=15021&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.B46a9d91e8e70c--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.C46a9d91f2e5e3--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;C46a9d91f2e5e3&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG10423 ECOCYC:EG10423]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG10423 EcoGene:EG10423]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=946614 GeneID:946614]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15021.C46a9d91f2e5e3&amp;page=15021&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.C46a9d91f2e5e3--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.A46a6f64ab76e7--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;A46a6f64ab76e7&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15021.A46a6f64ab76e7&amp;page=15021&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15021.A46a6f64ab76e7--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes not in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:gyr genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Ohs