EcoliWiki - User contributions [en]

coaE:Gene

2008-11-13T15:17:13Z

Jewertz: Table edited by Jewertz via TableEdit

{{#css:Suppresslinks.css}}<css>{{:Suppresslinks.css}}</css>
<noinclude>{{TabsTop}}
{{Tab|Quickview|coaE}}{{Tab On|Gene|coaE}}{{Tab|Gene Product(s)|coaE}}{{Tab|Expression|coaE}}{{Tab|Evolution|coaE}}{{Tab|On One Page|coaE}}{{TabsBottom}}
{|
|- style="background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;"
|{{Sub}}[[#Nomenclature |Nomenclature]]
|{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]
|{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]
|{{Sub}}[[#Genetic Resources |Genetic Resources]]
|{{Sub}}[[#Accessions in Other Databases |Accessions]]
|{{Sub}}[[#Links |Links]]
|{{Sub}}[[#References |References]]
|{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]
|}
</noinclude><protect>
==Nomenclature==
{{BacktoTop}}


{|{{Prettytable}}
|-
!{{table_heading_style}} |Standard name
|
''coaE''
|-
!{{table_heading_style}} |Mnemonic
|

|-
!{{table_heading_style}} |Synonyms
|
''ECK0103, b0103, JW0100, yacE''<ref name='LIB:Riley_2006'/>
|-
|colspan='2'|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.10783.K46a9a8855d2c2&page=10783&pagename={{FULLPAGENAMEE}} edit table]
|}

{{Gene_nomenclature_help}}
</protect>
===Notes===

==Location(s) and DNA Sequence==
{{BacktoTop}}
<protect>


{|class = 'sortable' {{Prettytable}} id='125547'
|- {{table_heading_style}}
!Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links
|-
|
MG1655
|
2.43 minutes 
|
MG1655: 113219..112599 {{GBrowseFigureByCoord|111599|114219|ecoli|MG1655}}
|
*[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG12312 EcoCyc]
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli/?q=MG1655:111599..114219 GBrowse(MG1655)]

|
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli/?plugin=FastaDumper&name=MG1655:112599..113219&plugin_action=Go FASTA Dump]
*[http://biocyc.org/ECOLI/sequence?object=EG12312 EcoCyc Sequence Dump]
|-
|
W3110
|
 
|
W3110: 113219..112599 {{GBrowseFigureByCoord|111599|114219|ecoli_W3110|W3110}}
|
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli_W3110/?q=W3110:111599..114219 GBrowse(W3110)]
|
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli_W3110/?plugin=FastaDumper&name=W3110:112599..113219&plugin_action=Go FASTA Dump]
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.10783.R46a9a885d97ae&page=10783&pagename={{FULLPAGENAMEE}} edit table] || || || ||
|}

{{Gene_location_help}}
</protect>
===Notes===

==Sequence Features==
{{BacktoTop}}


{|class = 'sortable' {{Prettytable}} id='125548'
|- {{table_heading_style}}
!Feature type!!Location!!Description
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.10783.B46a9a88682ce1&page=10783&pagename={{FULLPAGENAMEE}} edit table] || ||
|}

{{Gene_sequence_features_help}}
<protect></protect>
====Notes====

==Alleles and Phenotypes==
{{BacktoTop}}


{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" {{Prettytable}}
|- {{table_heading_style}}
!|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments
|-
|
ΔcoaE (Keio:JW0100)
|
deletion
|
deletion
|

|

|
[[PMID:16738554]]<ref name=PMID:16738554/>
|
[http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]
|

|-
|
''ΔcoaE722::kan''
|

|

|

|

|
[[PMID:16738554]]<ref name=PMID:16738554/>
|
[[cgscmutation:100358|CGSC:100358]]
|
This allele appears to not exist in the Keio collection. PCR analysis indicates an intact coaE gene in both JW0100 Keio strains.

|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.10783.Z46a9a886c3a26&page=10783&pagename={{FULLPAGENAMEE}}&type=&template=Gene_allele_table edit table] || || || || || || ||
|}

{{Gene_alleles_help}}
<protect></protect>
===Notes===

==Genetic Resources==
{{BacktoTop}}


{|class = 'sortable' {{Prettytable}} id='125550'
|- {{table_heading_style}}
!Resource!!Resource Type!!Source!!Notes/Reference
|-
|
JW0100
|
Plasmid clone
|
[http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]
|
[[PMID:16769691]]<ref name=PMID:16769691/>

Status:Clone OK

Primer 1:GCCAGGTATATAGTTGCCTTAAC

Primer 2:CCCGGTTTTTCCTGTGAGACAAA
|-
|
leuO3051::Tn10
|
Linked marker
|
CAG12095 = [http://cgsc2.biology.yale.edu/Strain.php?ID=37901 CGSC7324]<ref name='LIB:cgsc'/>
|
est. P1 cotransduction: 32% <ref name='LIB:Nichols_linked_Tn'/>

Synonyms:zab-3051::Tn10

The start of leuO was reannotated by Riley et al. (2006).
|-
|
[[yadC:Gene|zad-220::Tn10]]
|
Linked marker
|
CAG12025 = [http://cgsc2.biology.yale.edu/Strain.php?ID=38011 CGSC7326]<ref name='LIB:cgsc'/>
|
est. P1 cotransduction: 23% <ref name='LIB:Nichols_linked_Tn'/>
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.10783.V46a9a8876bc82&page=10783&pagename={{FULLPAGENAMEE}} edit table] || || ||
|}

{{Gene_resources_help}}
<protect></protect>
===Notes===

==Accessions in Other Databases==
{{BacktoTop}}


{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"
|- {{table_heading_style}}
!|Database!!Accession!!Notes
|-
|
[http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])
|
[http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&object=EG12312 EcoCyc:EG12312]
|

|-
|
[http://www.ecoli-york.org EchoBASE] ([[EchoBASE|EcoliWiki Page]])
|
[http://www.york.ac.uk/res/thomas/Gene.cfm?recordID=EB2218 EchoBASE:EB2218]
|

|-
|
[http://chase.ou.edu/oubcf/index.php EcoliGenExpDB] ([[EcoliGenExpDB|EcoliWiki Page]])
|
[http://chase.ou.edu/macro/searchlink.php?bnum=b0103 EcoliGenExpDB:b0103]
|

|-
|
[http://BioCyc.org/ECOL199310/ ECOL199310CYC] ([[ECOL199310CYC|EcoliWiki Page]])
|
[http://BioCyc.org/ECOL199310/new-image?object=C0123 ECOL199310CYC:C0123]
|

|-
|
[http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])
|
[http://ecogene.org/geneinfo.php?eg_id=EG12312 EcoGene:EG12312]
|

|-
|
[http://BioCyc.org/ECOO157/ ECOO157CYC] ([[ECOO157CYC|EcoliWiki Page]])
|
[http://BioCyc.org/ECOO157/new-image?object=YACE ECOO157CYC:YACE]
|

|-
|
[https://asap.ahabs.wisc.edu/asap/logon.php ASAP] ([[ASAP|EcoliWikiPage]])
|
[http://asap.ahabs.wisc.edu/asap/feature_info.php?LocationID=WIS&FeatureID=0000357&formSubmitReturn=1 ASAP:ABE-0000357]
|

|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.10783.D46a9a88801f1f&page=10783&pagename={{FULLPAGENAMEE}}&type=0&template=Gene_accessions_table edit table] || ||
|}

{{Gene_accessions_help}}
<protect></protect>
===Notes===

==Links==
{{BacktoTop}}


{|class = 'sortable' {{Prettytable}} id='96228'
|- {{table_heading_style}}
!Name!!URL!!Comments
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.10783.O46a675be361c1&page=10783&pagename={{FULLPAGENAMEE}} edit table] || ||
|}

{{Links_help}}

<noinclude><protect>
==References==
{{BacktoTop}}
{{RefHelp}}
<references/>
__NOTOC__
</protect></noinclude>
===Categories===
[[Category:Gene List:MG1655]]
[[Category:Gene List:W3110]]
[[Category:Genes in the Keio knockout collection]]
[[Category:Genes in the ASKA clone collection]]
[[Category:coa genes]]

coaE:Gene

2008-11-13T15:14:51Z

Jewertz: Table edited by Jewertz via TableEdit

{{#css:Suppresslinks.css}}<css>{{:Suppresslinks.css}}</css>
<noinclude>{{TabsTop}}
{{Tab|Quickview|coaE}}{{Tab On|Gene|coaE}}{{Tab|Gene Product(s)|coaE}}{{Tab|Expression|coaE}}{{Tab|Evolution|coaE}}{{Tab|On One Page|coaE}}{{TabsBottom}}
{|
|- style="background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;"
|{{Sub}}[[#Nomenclature |Nomenclature]]
|{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]
|{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]
|{{Sub}}[[#Genetic Resources |Genetic Resources]]
|{{Sub}}[[#Accessions in Other Databases |Accessions]]
|{{Sub}}[[#Links |Links]]
|{{Sub}}[[#References |References]]
|{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]
|}
</noinclude><protect>
==Nomenclature==
{{BacktoTop}}


{|{{Prettytable}}
|-
!{{table_heading_style}} |Standard name
|
''coaE''
|-
!{{table_heading_style}} |Mnemonic
|

|-
!{{table_heading_style}} |Synonyms
|
''ECK0103, b0103, JW0100, yacE''<ref name='LIB:Riley_2006'/>
|-
|colspan='2'|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.10783.K46a9a8855d2c2&page=10783&pagename={{FULLPAGENAMEE}} edit table]
|}

{{Gene_nomenclature_help}}
</protect>
===Notes===

==Location(s) and DNA Sequence==
{{BacktoTop}}
<protect>


{|class = 'sortable' {{Prettytable}} id='125547'
|- {{table_heading_style}}
!Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links
|-
|
MG1655
|
2.43 minutes 
|
MG1655: 113219..112599 {{GBrowseFigureByCoord|111599|114219|ecoli|MG1655}}
|
*[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&chromosome=COLI-K12&object=EG12312 EcoCyc]
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli/?q=MG1655:111599..114219 GBrowse(MG1655)]

|
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli/?plugin=FastaDumper&name=MG1655:112599..113219&plugin_action=Go FASTA Dump]
*[http://biocyc.org/ECOLI/sequence?object=EG12312 EcoCyc Sequence Dump]
|-
|
W3110
|
 
|
W3110: 113219..112599 {{GBrowseFigureByCoord|111599|114219|ecoli_W3110|W3110}}
|
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli_W3110/?q=W3110:111599..114219 GBrowse(W3110)]
|
*[http://dimer.tamu.edu/cgi-bin/gb/gbrowse/ecoli_W3110/?plugin=FastaDumper&name=W3110:112599..113219&plugin_action=Go FASTA Dump]
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.10783.R46a9a885d97ae&page=10783&pagename={{FULLPAGENAMEE}} edit table] || || || ||
|}

{{Gene_location_help}}
</protect>
===Notes===

==Sequence Features==
{{BacktoTop}}


{|class = 'sortable' {{Prettytable}} id='125548'
|- {{table_heading_style}}
!Feature type!!Location!!Description
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.10783.B46a9a88682ce1&page=10783&pagename={{FULLPAGENAMEE}} edit table] || ||
|}

{{Gene_sequence_features_help}}
<protect></protect>
====Notes====

==Alleles and Phenotypes==
{{BacktoTop}}


{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;" {{Prettytable}}
|- {{table_heading_style}}
!|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments
|-
|
ΔcoaE (Keio:JW0100)
|
deletion
|
deletion
|

|

|
[[PMID:16738554]]<ref name=PMID:16738554/>
|
[http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen] [http://cgsc2.biology.yale.edu/Strain.php?ID=106663 CGSC8382]<ref name='LIB:cgsc'/>
|

|-
|
''ΔcoaE722::kan''
|

|

|

|

|
[[PMID:16738554]]<ref name=PMID:16738554/>
|
[[cgscmutation:100358|CGSC:100358]]
|
This allele appears to not exist in the Keio collection. PCR analysis indicates an intact coaE gene in both JW0100 Keio strains.

|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.10783.Z46a9a886c3a26&page=10783&pagename={{FULLPAGENAMEE}}&type=&template=Gene_allele_table edit table] || || || || || || ||
|}

{{Gene_alleles_help}}
<protect></protect>
===Notes===

==Genetic Resources==
{{BacktoTop}}


{|class = 'sortable' {{Prettytable}} id='125550'
|- {{table_heading_style}}
!Resource!!Resource Type!!Source!!Notes/Reference
|-
|
JW0100
|
Plasmid clone
|
[http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]
|
[[PMID:16769691]]<ref name=PMID:16769691/>

Status:Clone OK

Primer 1:GCCAGGTATATAGTTGCCTTAAC

Primer 2:CCCGGTTTTTCCTGTGAGACAAA
|-
|
leuO3051::Tn10
|
Linked marker
|
CAG12095 = [http://cgsc2.biology.yale.edu/Strain.php?ID=37901 CGSC7324]<ref name='LIB:cgsc'/>
|
est. P1 cotransduction: 32% <ref name='LIB:Nichols_linked_Tn'/>

Synonyms:zab-3051::Tn10

The start of leuO was reannotated by Riley et al. (2006).
|-
|
[[yadC:Gene|zad-220::Tn10]]
|
Linked marker
|
CAG12025 = [http://cgsc2.biology.yale.edu/Strain.php?ID=38011 CGSC7326]<ref name='LIB:cgsc'/>
|
est. P1 cotransduction: 23% <ref name='LIB:Nichols_linked_Tn'/>
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.10783.V46a9a8876bc82&page=10783&pagename={{FULLPAGENAMEE}} edit table] || || ||
|}

{{Gene_resources_help}}
<protect></protect>
===Notes===

==Accessions in Other Databases==
{{BacktoTop}}


{|class = 'sortable' border="2" cellpadding="4" cellspacing="0" style="margin: 1em 1em 1em 0; border: 1px #aaa solid; border-collapse: collapse;"
|- {{table_heading_style}}
!|Database!!Accession!!Notes
|-
|
[http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])
|
[http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&object=EG12312 EcoCyc:EG12312]
|

|-
|
[http://www.ecoli-york.org EchoBASE] ([[EchoBASE|EcoliWiki Page]])
|
[http://www.york.ac.uk/res/thomas/Gene.cfm?recordID=EB2218 EchoBASE:EB2218]
|

|-
|
[http://chase.ou.edu/oubcf/index.php EcoliGenExpDB] ([[EcoliGenExpDB|EcoliWiki Page]])
|
[http://chase.ou.edu/macro/searchlink.php?bnum=b0103 EcoliGenExpDB:b0103]
|

|-
|
[http://BioCyc.org/ECOL199310/ ECOL199310CYC] ([[ECOL199310CYC|EcoliWiki Page]])
|
[http://BioCyc.org/ECOL199310/new-image?object=C0123 ECOL199310CYC:C0123]
|

|-
|
[http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])
|
[http://ecogene.org/geneinfo.php?eg_id=EG12312 EcoGene:EG12312]
|

|-
|
[http://BioCyc.org/ECOO157/ ECOO157CYC] ([[ECOO157CYC|EcoliWiki Page]])
|
[http://BioCyc.org/ECOO157/new-image?object=YACE ECOO157CYC:YACE]
|

|-
|
[https://asap.ahabs.wisc.edu/asap/logon.php ASAP] ([[ASAP|EcoliWikiPage]])
|
[http://asap.ahabs.wisc.edu/asap/feature_info.php?LocationID=WIS&FeatureID=0000357&formSubmitReturn=1 ASAP:ABE-0000357]
|

|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.10783.D46a9a88801f1f&page=10783&pagename={{FULLPAGENAMEE}}&type=0&template=Gene_accessions_table edit table] || ||
|}

{{Gene_accessions_help}}
<protect></protect>
===Notes===

==Links==
{{BacktoTop}}


{|class = 'sortable' {{Prettytable}} id='96228'
|- {{table_heading_style}}
!Name!!URL!!Comments
|-class='sortbottom'
|[{{SERVER}}{{SCRIPTPATH}}/index.php?title=Special:TableEdit&id=421aa90e079fa326b6494f812ad13e79.10783.O46a675be361c1&page=10783&pagename={{FULLPAGENAMEE}} edit table] || ||
|}

{{Links_help}}

<noinclude><protect>
==References==
{{BacktoTop}}
{{RefHelp}}
<references/>
__NOTOC__
</protect></noinclude>
===Categories===
[[Category:Gene List:MG1655]]
[[Category:Gene List:W3110]]
[[Category:Genes in the Keio knockout collection]]
[[Category:Genes in the ASKA clone collection]]
[[Category:coa genes]]

E. coli Genetic Stock Center (CGSC)

2007-10-10T14:38:27Z

Jewertz:

{{Pagetop}}
[[Category:Databases]]
[[Category:EcoliHub Partner]]
[[Category:E. coli Databases]]
{|{{Prettytable}} width='30%' align = 'right'
|- align='center' bgcolor = '#ddddff'
| colspan = '2' | '''{{PAGENAME}}'''
|-
| width='30%' | Who:
| John Wertz, Yale Univ.
|-
| width='30%' | What:
| Coli Genetic Stock Center; strains and genetic information
|-
| Where:
| [http://cgsc2.biology.yale.edu/ {{PAGENAME}}]
|-
| Updates
|
|-
| Upcoming events
|
|-
| Web Services
|
|}
=About {{PAGENAME}}=
The [http://cgsc2.biology.yale.edu/ {{PAGENAME}}] houses a collection of approx 18,000 nonpathogenic ''E. coli'' strains (as of Fall 2007), and has provided lab strains and advice on strain choice and strain construction to the ''E. coli'' community since 1971. Although strains used to be provided free of charge to academic users, the stock center has recently instituted a very [http://cgsc2.biology.yale.edu/charges.php small subscription fee] to help defray its operating costs, which are also supported by NSF. The CGSC is an EcoliHub partner site.

=Content=
The content of the CGSC website includes information about the stock center and about how to order strains, but the meat of the website from a user perspective is a series of query pages that allow a user to hunt for strains in the CGSC collection that have a desired set of properties.

=Using {{PAGENAME}}=
==Browsing==
There is currently no easy way to browse through the CGSC collection. One can see large sets of strains in the collection, however by using the STRAIN query page to search for strains that are Hfr, F+, F-, or F'. This will yield a list of strain names without any description.

==Searching==
CGSC provides several different ways to search its strain collection. If a unique hit is found, CGSC displays the page for the appropriate strain. If more than one hit is found, CGSC displays a list of strain names found. A short description for each strain in these lists would be helpful; the user has to click each one to decide which is most appropriate.
===Strain===
The strain query is probably the most commonly used. Of special note is the set of "special use" strains that can be selected from a menu.
===Mutation===
This allows the user to determine what mutant alleles are present in the collection
===Site===
===Gene Product===
===Reference===

==Usage examples==
''Add links to additional pages describing success stories here.''

=Other sites with related content=
=Technology=
==Web Services/API==
=Discussion=

=References=
=External Links=
[http://cgsc2.biology.yale.edu/ {{PAGENAME}}]
==Discussion of {{PAGENAME}} on other websites==

E. coli Genetic Stock Center (CGSC)

2007-10-10T14:35:07Z

Jewertz: /* About {{PAGENAME}} */

{{Pagetop}}
[[Category:Databases]]
[[Category:EcoliHub Partner]]
[[Category:E. coli Databases]]
{|{{Prettytable}} width='30%' align = 'right'
|- align='center' bgcolor = '#ddddff'
| colspan = '2' | '''{{PAGENAME}}'''
|-
| width='30%' | Who:
| Mary Berlyn, Yale Univ.
|-
| width='30%' | What:
| Coli Genetic Stock Center; strains and genetic information
|-
| Where:
| [http://cgsc.biology.yale.edu/ {{PAGENAME}}]
|-
| Updates
|
|-
| Upcoming events
|
|-
| Web Services
|
|}
=About {{PAGENAME}}=
The [http://cgsc2.biology.yale.edu/ {{PAGENAME}}] houses a collection of approx 18,000 nonpathogenic ''E. coli'' strains (as of Fall 2007), and has provided lab strains and advice on strain choice and strain construction to the ''E. coli'' community since 1971. Although strains used to be provided free of charge to academic users, the stock center has recently instituted a very [http://cgsc2.biology.yale.edu/charges.php small subscription fee] to help defray its operating costs, which are also supported by NSF. The CGSC is an EcoliHub partner site.

=Content=
The content of the CGSC website includes information about the stock center and about how to order strains, but the meat of the website from a user perspective is a series of query pages that allow a user to hunt for strains in the CGSC collection that have a desired set of properties.

=Using {{PAGENAME}}=
==Browsing==
There is currently no easy way to browse through the CGSC collection. One can see large sets of strains in the collection, however by using the STRAIN query page to search for strains that are Hfr, F+, F-, or F'. This will yield a list of strain names without any description.

==Searching==
CGSC provides several different ways to search its strain collection. If a unique hit is found, CGSC displays the page for the appropriate strain. If more than one hit is found, CGSC displays a list of strain names found. A short description for each strain in these lists would be helpful; the user has to click each one to decide which is most appropriate.
===Strain===
The strain query is probably the most commonly used. Of special note is the set of "special use" strains that can be selected from a menu.
===Mutation===
This allows the user to determine what mutant alleles are present in the collection
===Site===
===Gene Product===
===Reference===

==Usage examples==
''Add links to additional pages describing success stories here.''

=Other sites with related content=
=Technology=
==Web Services/API==
=Discussion=

=References=
=External Links=
[http://cgsc2.biology.yale.edu/ {{PAGENAME}}]
==Discussion of {{PAGENAME}} on other websites==

E. coli Genetic Stock Center (CGSC)

2007-10-10T14:33:56Z

Jewertz: /* External Links */

{{Pagetop}}
[[Category:Databases]]
[[Category:EcoliHub Partner]]
[[Category:E. coli Databases]]
{|{{Prettytable}} width='30%' align = 'right'
|- align='center' bgcolor = '#ddddff'
| colspan = '2' | '''{{PAGENAME}}'''
|-
| width='30%' | Who:
| Mary Berlyn, Yale Univ.
|-
| width='30%' | What:
| Coli Genetic Stock Center; strains and genetic information
|-
| Where:
| [http://cgsc.biology.yale.edu/ {{PAGENAME}}]
|-
| Updates
|
|-
| Upcoming events
|
|-
| Web Services
|
|}
=About {{PAGENAME}}=
The [http://cgsc2.biology.yale.edu/ {{PAGENAME}}] houses a collection of approx 18,000 nonpathogenic ''E. coli'' strains (as of Fall 2007), and has provided lab strains and advice on strain choice and strain construction to the ''E. coli'' community since 1971. Although strains used to be provided free of charge to academic users, the stock center has recently instituted a very [http://cgsc2.biology.yale.edu/chargesnew.html small subscription fee] to help defray its operating costs, which are also supported by NSF. The CGSC is an EcoliHub partner site.

=Content=
The content of the CGSC website includes information about the stock center and about how to order strains, but the meat of the website from a user perspective is a series of query pages that allow a user to hunt for strains in the CGSC collection that have a desired set of properties.

=Using {{PAGENAME}}=
==Browsing==
There is currently no easy way to browse through the CGSC collection. One can see large sets of strains in the collection, however by using the STRAIN query page to search for strains that are Hfr, F+, F-, or F'. This will yield a list of strain names without any description.

==Searching==
CGSC provides several different ways to search its strain collection. If a unique hit is found, CGSC displays the page for the appropriate strain. If more than one hit is found, CGSC displays a list of strain names found. A short description for each strain in these lists would be helpful; the user has to click each one to decide which is most appropriate.
===Strain===
The strain query is probably the most commonly used. Of special note is the set of "special use" strains that can be selected from a menu.
===Mutation===
This allows the user to determine what mutant alleles are present in the collection
===Site===
===Gene Product===
===Reference===

==Usage examples==
''Add links to additional pages describing success stories here.''

=Other sites with related content=
=Technology=
==Web Services/API==
=Discussion=

=References=
=External Links=
[http://cgsc2.biology.yale.edu/ {{PAGENAME}}]
==Discussion of {{PAGENAME}} on other websites==

E. coli Genetic Stock Center (CGSC)

2007-10-10T14:33:17Z

Jewertz: /* About {{PAGENAME}} */

{{Pagetop}}
[[Category:Databases]]
[[Category:EcoliHub Partner]]
[[Category:E. coli Databases]]
{|{{Prettytable}} width='30%' align = 'right'
|- align='center' bgcolor = '#ddddff'
| colspan = '2' | '''{{PAGENAME}}'''
|-
| width='30%' | Who:
| Mary Berlyn, Yale Univ.
|-
| width='30%' | What:
| Coli Genetic Stock Center; strains and genetic information
|-
| Where:
| [http://cgsc.biology.yale.edu/ {{PAGENAME}}]
|-
| Updates
|
|-
| Upcoming events
|
|-
| Web Services
|
|}
=About {{PAGENAME}}=
The [http://cgsc2.biology.yale.edu/ {{PAGENAME}}] houses a collection of approx 18,000 nonpathogenic ''E. coli'' strains (as of Fall 2007), and has provided lab strains and advice on strain choice and strain construction to the ''E. coli'' community since 1971. Although strains used to be provided free of charge to academic users, the stock center has recently instituted a very [http://cgsc2.biology.yale.edu/chargesnew.html small subscription fee] to help defray its operating costs, which are also supported by NSF. The CGSC is an EcoliHub partner site.

=Content=
The content of the CGSC website includes information about the stock center and about how to order strains, but the meat of the website from a user perspective is a series of query pages that allow a user to hunt for strains in the CGSC collection that have a desired set of properties.

=Using {{PAGENAME}}=
==Browsing==
There is currently no easy way to browse through the CGSC collection. One can see large sets of strains in the collection, however by using the STRAIN query page to search for strains that are Hfr, F+, F-, or F'. This will yield a list of strain names without any description.

==Searching==
CGSC provides several different ways to search its strain collection. If a unique hit is found, CGSC displays the page for the appropriate strain. If more than one hit is found, CGSC displays a list of strain names found. A short description for each strain in these lists would be helpful; the user has to click each one to decide which is most appropriate.
===Strain===
The strain query is probably the most commonly used. Of special note is the set of "special use" strains that can be selected from a menu.
===Mutation===
This allows the user to determine what mutant alleles are present in the collection
===Site===
===Gene Product===
===Reference===

==Usage examples==
''Add links to additional pages describing success stories here.''

=Other sites with related content=
=Technology=
==Web Services/API==
=Discussion=

=References=
=External Links=
[http://cgsc.biology.yale.edu/ {{PAGENAME}}]
==Discussion of {{PAGENAME}} on other websites==