https://ecoliwiki.org/colipedia/api.php?action=feedcontributions&feedformat=atom&user=Gbenison 2026-11-05T08:02:19Z User contributions MediaWiki 1.43.11 https://ecoliwiki.org/colipedia/index.php?title=Talk:pRS551&diff=1362319 2011-10-28T22:11:53Z

<p>Gbenison: Created page with &#039;The sequence on this page (which corresponds to the sequence found by following the link) appears incorrect - it contains two EcoRI sites, not one. There is a file containing a ...&#039;</p> <hr /> <div>The sequence on this page (which corresponds to the sequence found by following the link) appears incorrect - it contains two EcoRI sites, not one. There is a file containing a &quot;pRS551&quot; sequence floating around my lab which differs from the one on this page by a single nucleotide:<br /> <br /> &lt; TATCGGCGCAATTCCAGCTGAGCGCCGGTCGCTACCATTA<br /> ---<br /> &gt; TATCGGCGGAATTCCAGCTGAGCGCCGGTCGCTACCATTA<br /> <br /> This mutation removes the second EcoRI site, which seems consistent with the drawn map, and how the actual plasmid behaves in digests.</div>

Gbenison