https://ecoliwiki.org/colipedia/api.php?action=feedcontributions&feedformat=atom&user=Denham EcoliWiki - User contributions [en] 2026-11-02T00:43:21Z User contributions MediaWiki 1.43.11 https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1362723 Bicyclomycin 2011-12-13T14:18:45Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>Bicyclomycin, discovered in 1972, has a structure that is unique among antibiotics. Currently used to treat nonspecific diarrhea, it has a low toxicity, and no cross-resistance with other antibiotics has yet been found. It is effective against many Gram-negative bacteria. Bicyclomycin is also effective against the Gram-positive bacterium ''Micrococcus luteus''.&lt;ref name='PMID:16181146'/&gt; It is the only known selective inhibitor of Rho.<br /> <br /> <br /> ===Mode of Action===<br /> Bicyclomycin inhibits Rho by being a reversible, noncompetitive inhibitor of ATP.&lt;ref name='PMID:16181146'/&gt;<br /> <br /> ===Structure===<br /> [[Image:bicyclomycin structure.gif]]<br /> <br /> NLM PubChem Public Chemical Database<br /> <br /> ===Targets===<br /> Bicyclomycin targets the transcription termination factor Rho.&lt;ref name='PMID:8466900'/&gt;<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> Genes in ''E. coli'' that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> <br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> |- <br /> |<br /> recA<br /> |<br /> deletion<br /> |<br /> increased senstivity <br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> recO<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> rdgC<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> trxA<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> trxB<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> minC<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> envC<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> csgG<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> pgpB<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> yciB<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> ydcS<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> ydcX<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> degP<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> dnaK<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> hscA<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> lon<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> rimK<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> rplA<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> rpsF<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> rlmE<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> dapF<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> fabF<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> gpmM<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> iscS<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> ycjU<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> hns<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> yciT<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> rzpQ<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> ydfA<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> ymfT<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> ybaB<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> yciM<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> ydhT<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> yebV<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1362267 Bicyclomycin 2011-10-24T13:11:18Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>Bicyclomycin, discovered in 1972, has a structure that is unique among antibiotics. Currently used to treat nonspecific diarrhea, it has a low toxicity, and no cross-resistance with other antibiotics has yet been found. It is effective against many Gram-negative bacteria. Bicyclomycin is also effective against the Gram-positive bacterium ''Micrococcus luteus''.&lt;ref name='PMID:16181146'/&gt; It is the only known selective inhibitor of Rho.<br /> <br /> <br /> ===Mode of Action===<br /> Bicyclomycin inhibits Rho by being a reversible, noncompetitive inhibitor of ATP.&lt;ref name='PMID:16181146'/&gt;<br /> <br /> ===Structure===<br /> [[Image:bicyclomycin structure.gif]]<br /> <br /> ===Targets===<br /> Bicyclomycin targets the transcription termination factor Rho.&lt;ref name='PMID:8466900'/&gt;<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> Genes in ''E. coli'' that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> <br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> |- <br /> |<br /> recA<br /> |<br /> deletion<br /> |<br /> increased senstivity <br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> recO<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> rdgC<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> trxA<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> trxB<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> minC<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> envC<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> csgG<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> pgpB<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> yciB<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> ydcS<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> ydcX<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1362266 Bicyclomycin 2011-10-24T13:07:08Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>Bicyclomycin, discovered in 1972, has a structure that is unique among antibiotics. Currently used to treat nonspecific diarrhea, it has a low toxicity, and no cross-resistance with other antibiotics has yet been found. It is effective against many Gram-negative bacteria. Bicyclomycin is also effective against the Gram-positive bacterium ''Micrococcus luteus''.&lt;ref name='PMID:16181146'/&gt; It is the only known selective inhibitor of Rho.<br /> <br /> <br /> ===Mode of Action===<br /> Bicyclomycin inhibits Rho by being a reversible, noncompetitive inhibitor of ATP.&lt;ref name='PMID:16181146'/&gt;<br /> <br /> ===Structure===<br /> [[Image:bicyclomycin structure.gif]]<br /> <br /> ===Targets===<br /> Bicyclomycin targets the transcription termination factor Rho.&lt;ref name='PMID:8466900'/&gt;<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> Genes in ''E. coli'' that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> <br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> |- <br /> |<br /> recA<br /> |<br /> deletion<br /> |<br /> increased senstivity <br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> recO<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> rdgC<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> |- <br /> |<br /> trxA<br /> |<br /> deletion<br /> |<br /> increased sensitivity<br /> |<br /> PMID:21357484 <br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1362265 Bicyclomycin 2011-10-24T13:04:08Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>Bicyclomycin, discovered in 1972, has a structure that is unique among antibiotics. Currently used to treat nonspecific diarrhea, it has a low toxicity, and no cross-resistance with other antibiotics has yet been found. It is effective against many Gram-negative bacteria. Bicyclomycin is also effective against the Gram-positive bacterium ''Micrococcus luteus''.&lt;ref name='PMID:16181146'/&gt; It is the only known selective inhibitor of Rho.<br /> <br /> <br /> ===Mode of Action===<br /> Bicyclomycin inhibits Rho by being a reversible, noncompetitive inhibitor of ATP.&lt;ref name='PMID:16181146'/&gt;<br /> <br /> ===Structure===<br /> [[Image:bicyclomycin structure.gif]]<br /> <br /> ===Targets===<br /> Bicyclomycin targets the transcription termination factor Rho.&lt;ref name='PMID:8466900'/&gt;<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> Genes in ''E. coli'' that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> <br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> |- <br /> |<br /> recA<br /> |<br /> deletion<br /> |<br /> increased senstivity <br /> |<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1362264 Bicyclomycin 2011-10-24T12:58:45Z <p>Denham: </p> <hr /> <div>Bicyclomycin, discovered in 1972, has a structure that is unique among antibiotics. Currently used to treat nonspecific diarrhea, it has a low toxicity, and no cross-resistance with other antibiotics has yet been found. It is effective against many Gram-negative bacteria. Bicyclomycin is also effective against the Gram-positive bacterium ''Micrococcus luteus''.&lt;ref name='PMID:16181146'/&gt; It is the only known selective inhibitor of Rho.<br /> <br /> <br /> ===Mode of Action===<br /> Bicyclomycin inhibits Rho by being a reversible, noncompetitive inhibitor of ATP.&lt;ref name='PMID:16181146'/&gt;<br /> <br /> ===Structure===<br /> [[Image:bicyclomycin structure.gif]]<br /> <br /> ===Targets===<br /> Bicyclomycin targets the transcription termination factor Rho.&lt;ref name='PMID:8466900'/&gt;<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> Genes in ''E. coli'' that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> <br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=recG:Gene&diff=1362168 recG:Gene 2011-10-06T16:04:47Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|recG}}{{Tab On|Gene|recG}}{{Tab|Gene Product(s)|recG}}{{Tab|Expression|recG}}{{Tab|Evolution|recG}}{{Tab|On One Page|recG}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17859.S46a9fb6b25e70--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;S46a9fb6b25e70&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''recG''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Recombination<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK3642, b3652, JW3627, spoV, radC''&lt;ref name='LIB:Riley_2006'/&gt;, radC''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17859.S46a9fb6b25e70&amp;page=17859&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17859.S46a9fb6b25e70--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17859.U46a9fb6ba8307--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;U46a9fb6ba8307&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 82.4 minutes&amp;nbsp;<br /> |<br /> MG1655: 3823233..3825314&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:3823233..3825314<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG10829 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|3822233|3826314|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|3823233|3825314|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG10829 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 3763567..3765648&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:3763567..3765648<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|3763567|3765648|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|3763567|3765648|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 3711566..3713647&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:3711566..3713647<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|3711566|3713647|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|3711566|3713647|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 3815205..3813124&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:3813124..3815205<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|3812124|3816205|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|3813124|3815205|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 3920817..3922898&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:3920817..3922898<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|3916655|3927060|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|3916655|3927060|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17859.U46a9fb6ba8307&amp;page=17859&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17859.U46a9fb6ba8307--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17859.R46a9fb6c6ba96--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;R46a9fb6c6ba96&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17859.R46a9fb6c6ba96&amp;page=17859&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17859.R46a9fb6c6ba96--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17859.B46a9fb6cb5982--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;B46a9fb6cb5982&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;recG (Keio:JW3627)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=108946 CGSC10665]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0011939 recG::Tn5KAN-I-SceI] (FB21370)<br /> |<br /> Insertion at nt 155 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB21370]<br /> |<br /> contains [[pKD46]] <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0011939 recG::Tn5KAN-I-SceI] (FB21371)<br /> |<br /> Insertion at nt 155 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB21371]<br /> |<br /> does not contain [[pKD46]] <br /> |- <br /> |<br /> recG<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> decreases sensitivity to [[Bicyclomycin]]<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> |- <br /> |<br /> ''recG2102''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:13916|CGSC:13916]]<br /> |<br /> <br /> |- <br /> |<br /> ''recG162''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:26965|CGSC:26965]]<br /> |<br /> <br /> |- <br /> |<br /> ''recG263(::kan)''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:8648624<br /> |<br /> [[cgscmutation:69150|CGSC:69150]]<br /> |<br /> <br /> |- <br /> |<br /> ''recG265(::cat)''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:69152|CGSC:69152]]<br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;recG756::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:102626|CGSC:102626]]<br /> |<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17859.B46a9fb6cb5982&amp;page=17859&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17859.B46a9fb6cb5982--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.17859.W4e04c22bbe900--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;W4e04c22bbe900&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.17859.W4e04c22bbe900&amp;page=17859&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.17859.W4e04c22bbe900--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17859.C46a9fb6d78f41--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;C46a9fb6d78f41&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW3627<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCAAAGGTCGCCTGTTAGATGC<br /> <br /> Primer 2:CCgGCATTCGAGTAACGTTCCGT <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:7F3|7F3]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=571 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> zhg-50::Tn10<br /> |<br /> Linked marker<br /> |<br /> CAG18450 = [http://cgsc2.biology.yale.edu/Strain.php?ID=37863 CGSC7450]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: % &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zhf-50::Tn10, zhf-5::Tn10 <br /> |- <br /> |<br /> zic-4901::Tn10<br /> |<br /> Linked marker<br /> |<br /> CAG18492 = [http://cgsc2.biology.yale.edu/Strain.php?ID=38944 CGSC7457]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 86% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17859.C46a9fb6d78f41&amp;page=17859&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17859.C46a9fb6d78f41--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17859.K46a9fb6e2366c--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;K46a9fb6e2366c&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG10829 ECOCYC:EG10829]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG10829 EcoGene:EG10829]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=948162 GeneID:948162]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17859.K46a9fb6e2366c&amp;page=17859&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17859.K46a9fb6e2366c--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17859.B46a715cab0045--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;B46a715cab0045&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17859.B46a715cab0045&amp;page=17859&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17859.B46a715cab0045--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:rec genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=recO:Gene&diff=1362167 recO:Gene 2011-10-06T15:53:36Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|recO}}{{Tab On|Gene|recO}}{{Tab|Gene Product(s)|recO}}{{Tab|Expression|recO}}{{Tab|Evolution|recO}}{{Tab|On One Page|recO}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15701.U46a9e10d9d604--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;U46a9e10d9d604&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''recO''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Recombination<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK2563, b2565, JW2549''&lt;ref name='LIB:Riley_2006'/&gt;, JW2549''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15701.U46a9e10d9d604&amp;page=15701&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15701.U46a9e10d9d604--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15701.H46a9e10e273a0--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;H46a9e10e273a0&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 58.19 minutes&amp;nbsp;<br /> |<br /> MG1655: 2700491..2699763&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:2699763..2700491<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG10832 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|2698763|2701491|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|2699763|2700491|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG10832 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 2623961..2623233&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:2623233..2623961<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|2623233|2623961|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|2623233|2623961|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 2585568..2586296&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:2585568..2586296<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|2585568|2586296|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|2585568|2586296|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 2701125..2700397&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:2700397..2701125<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|2699397|2702125|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|2700397|2701125|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 2792256..2791528&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:2791528..2792256<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|2790072|2793712|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|2790072|2793712|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15701.H46a9e10e273a0&amp;page=15701&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15701.H46a9e10e273a0--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15701.H46a9e10ed4a88--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;H46a9e10ed4a88&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15701.H46a9e10ed4a88&amp;page=15701&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15701.H46a9e10ed4a88--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15701.C46a9e10f2720c--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;C46a9e10f2720c&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;recO (Keio:JW2549)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=108309 CGSC10028]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;recO737::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:102630|CGSC:102630]]<br /> |<br /> <br /> |- <br /> |<br /> recO<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases sensitivity to [[Bicyclomycin]]<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15701.C46a9e10f2720c&amp;page=15701&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15701.C46a9e10f2720c--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.15701.W4e04c22fa7a4c--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;W4e04c22fa7a4c&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.15701.W4e04c22fa7a4c&amp;page=15701&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.15701.W4e04c22fa7a4c--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15701.T46a9e10fd4f2d--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;T46a9e10fd4f2d&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> <br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:<br /> <br /> Primer 1:<br /> <br /> Primer 2: <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:7G4|7G4]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=434 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[hcaT:Gene|zfh-208::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18481 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40086 CGSC7417]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 22% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zff-208::Tn10 <br /> |- <br /> |<br /> [[nadB:Gene|nadB51::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18480 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40090 CGSC7419]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 72% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15701.T46a9e10fd4f2d&amp;page=15701&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15701.T46a9e10fd4f2d--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15701.C46a9e11077356--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;C46a9e11077356&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG10832 ECOCYC:EG10832]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG10832 EcoGene:EG10832]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=947038 GeneID:947038]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15701.C46a9e11077356&amp;page=15701&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15701.C46a9e11077356--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15701.O46a6fdc99a666--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;O46a6fdc99a666&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15701.O46a6fdc99a666&amp;page=15701&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15701.O46a6fdc99a666--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:rec genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=recF:Gene&diff=1362166 recF:Gene 2011-10-06T15:52:37Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|recF}}{{Tab On|Gene|recF}}{{Tab|Gene Product(s)|recF}}{{Tab|Expression|recF}}{{Tab|Evolution|recF}}{{Tab|On One Page|recF}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17959.V46a9fca6b9082--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;V46a9fca6b9082&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''recF''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Recombination<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK3692, b3700, JW3677, uvrF''&lt;ref name='LIB:Riley_2006'/&gt;, uvrF''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17959.V46a9fca6b9082&amp;page=17959&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17959.V46a9fca6b9082--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17959.X46a9fca747553--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;X46a9fca747553&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 83.59 minutes, 83.59 minutes&amp;nbsp;<br /> |<br /> MG1655: 3879244..3878171&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:3878171..3879244<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG10828 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|3877171|3880244|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|3878171|3879244|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG10828 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 3841582..3840509&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:3840509..3841582<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|3840509|3841582|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|3840509|3841582|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 3766504..3767577&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:3766504..3767577<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|3766504|3767577|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|3766504|3767577|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 3759194..3760267&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:3759194..3760267<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|3758194|3761267|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|3759194|3760267|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 3976828..3975755&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:3975755..3976828<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|3973609|3978974|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|3973609|3978974|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17959.X46a9fca747553&amp;page=17959&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17959.X46a9fca747553--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17959.W46a9fca811245--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;W46a9fca811245&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> |- <br /> |<br /> Coding Start (SO:0000323)<br /> |<br /> [[MG1655]]<br /> |<br /> 3878174<br /> |<br /> Edman degradation<br /> |<br /> PMID:2228960&lt;br /&gt;<br /> |<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17959.W46a9fca811245&amp;page=17959&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17959.W46a9fca811245--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17959.V46a9fca85b470--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;V46a9fca85b470&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;recF (Keio:JW3677)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]<br /> |<br /> <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0012095 recF::Tn5KAN-I-SceI] (FB21402)<br /> |<br /> Insertion at nt 370 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB21402]<br /> |<br /> does not contain [[pKD46]] <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0012095 recF::Tn5KAN-I-SceI] (FB21403)<br /> |<br /> Insertion at nt 370 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB21403]<br /> |<br /> contains [[pKD46]] <br /> |- <br /> |<br /> recFK36R<br /> |<br /> <br /> |<br /> K36R<br /> |<br /> <br /> |<br /> Weakly active<br /> |<br /> <br /> |<br /> <br /> |<br /> seeded from [http://www.uniprot.org/uniprot/P0A7H0 UniProt:P0A7H0] <br /> |- <br /> |<br /> ''recF143''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:10318|CGSC:10318]]<br /> |<br /> <br /> |- <br /> |<br /> ''recF400::Tn5''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:2841294<br /> |<br /> [[cgscmutation:67402|CGSC:67402]]<br /> |<br /> <br /> |- <br /> |<br /> recF<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> decreases sensitivity to [[Bicyclomycin]]<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17959.V46a9fca85b470&amp;page=17959&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17959.V46a9fca85b470--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.17959.F4e04c22a90e75--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;F4e04c22a90e75&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.17959.F4e04c22a90e75&amp;page=17959&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.17959.F4e04c22a90e75--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17959.V46a9fca91eff6--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;V46a9fca91eff6&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW3677<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCTCCCTCACCCGCTTGTTGAT<br /> <br /> Primer 2:CCATCCGTTATTTTACCCTTTTC <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:3C10|3C10]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=565 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> zid-501::Tn10<br /> |<br /> Linked marker<br /> |<br /> CAG18499 = [http://cgsc2.biology.yale.edu/Strain.php?ID=38945 CGSC7458]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 87% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> |- <br /> |<br /> [[rbsA:Gene|rbsD296::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18501 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40333 CGSC7460]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 9% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zie-296::Tn10 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17959.V46a9fca91eff6&amp;page=17959&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17959.V46a9fca91eff6--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17959.K46a9fca9be3ad--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;K46a9fca9be3ad&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG10828 ECOCYC:EG10828]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG10828 EcoGene:EG10828]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=948209 GeneID:948209]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17959.K46a9fca9be3ad&amp;page=17959&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17959.K46a9fca9be3ad--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17959.Y46a716e31cfbf--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;Y46a716e31cfbf&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17959.Y46a716e31cfbf&amp;page=17959&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17959.Y46a716e31cfbf--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:rec genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=recC:Gene&diff=1362165 recC:Gene 2011-10-06T15:50:17Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|recC}}{{Tab On|Gene|recC}}{{Tab|Gene Product(s)|recC}}{{Tab|Expression|recC}}{{Tab|Evolution|recC}}{{Tab|On One Page|recC}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16211.F46a9e719ec5f5--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;F46a9e719ec5f5&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''recC''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Recombination<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK2818, b2822, JW2790''&lt;ref name='LIB:Riley_2006'/&gt;, JW2790''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.16211.F46a9e719ec5f5&amp;page=16211&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16211.F46a9e719ec5f5--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16211.R46a9e71a76b06--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;R46a9e71a76b06&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 63.73 minutes&amp;nbsp;<br /> |<br /> MG1655: 2960450..2957082&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:2957082..2960450<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG10825 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|2956082|2961450|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|2957082|2960450|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG10825 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 2857047..2853679&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:2853679..2857047<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|2853679|2857047|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|2853679|2857047|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 2844230..2847598&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:2844230..2847598<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|2844230|2847598|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|2844230|2847598|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 2961084..2957716&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:2957716..2961084<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|2956716|2962084|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|2957716|2961084|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 3054320..3050952&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:3050952..3054320<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|3044216|3061056|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|3044216|3061056|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.16211.R46a9e71a76b06&amp;page=16211&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16211.R46a9e71a76b06--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16211.W46a9e71b33111--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;W46a9e71b33111&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> |- <br /> |<br /> Coding Start (SO:0000323)<br /> |<br /> [[MG1655]]<br /> |<br /> 2957082<br /> |<br /> Edman degradation<br /> |<br /> PMID:3520484&lt;br /&gt;<br /> |<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.16211.W46a9e71b33111&amp;page=16211&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16211.W46a9e71b33111--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16211.Q46a9e71b7a05f--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;Q46a9e71b7a05f&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;recC (Keio:JW2790)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]<br /> |<br /> <br /> |- <br /> |<br /> ''recC22''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:350827<br /> |<br /> [[cgscmutation:4678|CGSC:4678]]<br /> |<br /> <br /> |- <br /> |<br /> ''recC1010''(Nuc-)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> ds DNA exonuclease-minus<br /> |<br /> <br /> |<br /> [[cgscmutation:10512|CGSC:10512]]<br /> |<br /> <br /> |- <br /> |<br /> ''recC73''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:350827<br /> |<br /> [[cgscmutation:10532|CGSC:10532]]<br /> |<br /> <br /> |- <br /> |<br /> ''recC1002(Chi&lt;sup&gt;-&lt;/sup&gt;)''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:10534|CGSC:10534]]<br /> |<br /> <br /> |- <br /> |<br /> ''recC1003(Chi&lt;sup&gt;-&lt;/sup&gt;)''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:10536|CGSC:10536]]<br /> |<br /> <br /> |- <br /> |<br /> ''recC1004(Chi&lt;sup&gt;-&lt;/sup&gt;)''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:10539|CGSC:10539]]<br /> |<br /> <br /> |- <br /> |<br /> ''recC1001(Chi&lt;sup&gt;-&lt;/sup&gt;)''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:10540|CGSC:10540]]<br /> |<br /> <br /> |- <br /> |<br /> ''recC23''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:16759|CGSC:16759]]<br /> |<br /> <br /> |- <br /> |<br /> recC<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> decreases sensitivity to [[Bicyclomycin]]<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.16211.Q46a9e71b7a05f&amp;page=16211&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16211.Q46a9e71b7a05f--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.16211.J4e04c22730b25--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;J4e04c22730b25&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.16211.J4e04c22730b25&amp;page=16211&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.16211.J4e04c22730b25--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16211.H46a9e71c35d6b--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;H46a9e71c35d6b&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW2790<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCTTAAGGGTCTACCATTCCAA<br /> <br /> Primer 2:CCTGACTGATTAAAGCGAAACAG <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:3G11|3G11]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=460 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:5A10|5A10]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=461 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[recD:Gene|recD1901::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12135 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40106 CGSC7429]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 81% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> |- <br /> |<br /> [[speA:Gene|speA210::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12168 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40110 CGSC7431]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: % &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zgd-210::Tn10, zgf-210::Tn10 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.16211.H46a9e71c35d6b&amp;page=16211&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16211.H46a9e71c35d6b--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16211.F46a9e71cce5da--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;F46a9e71cce5da&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG10825 ECOCYC:EG10825]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG10825 EcoGene:EG10825]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=947294 GeneID:947294]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.16211.F46a9e71cce5da&amp;page=16211&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16211.F46a9e71cce5da--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16211.U46a7035e0a1b3--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;U46a7035e0a1b3&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.16211.U46a7035e0a1b3&amp;page=16211&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16211.U46a7035e0a1b3--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:rec genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=lexA:Gene&diff=1362164 lexA:Gene 2011-10-06T15:46:12Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|lexA}}{{Tab On|Gene|lexA}}{{Tab|Gene Product(s)|lexA}}{{Tab|Expression|lexA}}{{Tab|Evolution|lexA}}{{Tab|On One Page|lexA}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18645.F46aa058a7e25a--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;F46aa058a7e25a&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''lexA''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Lambda excision<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK4035, b4043, JW4003, exrA, tsl, umuA''&lt;ref name='LIB:Riley_2006'/&gt;, spr, umuA''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18645.F46aa058a7e25a&amp;page=18645&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18645.F46aa058a7e25a--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18645.Q46aa058b0e011--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;Q46aa058b0e011&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 91.71 minutes&amp;nbsp;<br /> |<br /> MG1655: 4255138..4255746&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:4255138..4255746<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG10533 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|4254138|4256746|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|4255138|4255746|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG10533 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 4236047..4236655&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:4236047..4236655<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|4236047|4236655|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|4236047|4236655|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 4193983..4194591&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:4193983..4194591<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|4193983|4194591|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|4193983|4194591|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 4260705..4261313&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:4260705..4261313<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|4259705|4262313|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|4260705|4261313|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 4354834..4355442&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:4354834..4355442<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|4353618|4356658|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|4353618|4356658|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18645.Q46aa058b0e011&amp;page=18645&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18645.Q46aa058b0e011--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18645.L46aa058bc99aa--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;L46aa058bc99aa&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18645.L46aa058bc99aa&amp;page=18645&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18645.L46aa058bc99aa--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> A description of the ''lexA'' gene may be found in Markham ''et al.'' (1981)&lt;ref name='PMID:6272195'/&gt;.<br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18645.D46aa058c206f8--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;D46aa058c206f8&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> lexAG85D<br /> |<br /> <br /> |<br /> G85D<br /> |<br /> <br /> |<br /> (in lexA3, resistant to cleavage)<br /> |<br /> <br /> |<br /> <br /> |<br /> Strain variation; seeded from [http://www.uniprot.org/uniprot/P0A7C2 UniProt:P0A7C2] <br /> |- <br /> |<br /> ''lexA107''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:6267|CGSC:6267]]<br /> |<br /> <br /> |- <br /> |<br /> ''lexA1''(Ind-)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> non-inducible SOS response<br /> |<br /> <br /> |<br /> [[cgscmutation:9237|CGSC:9237]]<br /> |<br /> <br /> |- <br /> |<br /> ''lexA41''(ts)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> temperature sensitive<br /> |<br /> <br /> |<br /> [[cgscmutation:9601|CGSC:9601]]<br /> |<br /> <br /> |- <br /> |<br /> ''lexA3''(Ind-)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> non-inducible SOS response<br /> |<br /> <br /> |<br /> [[cgscmutation:9602|CGSC:9602]]<br /> |<br /> <br /> |- <br /> |<br /> ''lexA51''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:10280|CGSC:10280]]<br /> |<br /> <br /> |- <br /> |<br /> ''lexA101''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:11964|CGSC:11964]]<br /> |<br /> <br /> |- <br /> |<br /> ''lexA102''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:11979|CGSC:11979]]<br /> |<br /> <br /> |- <br /> |<br /> ''lexA109''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:11985|CGSC:11985]]<br /> |<br /> <br /> |- <br /> |<br /> ''lexA103''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:14425|CGSC:14425]]<br /> |<br /> <br /> |- <br /> |<br /> ''lexA104''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:14427|CGSC:14427]]<br /> |<br /> <br /> |- <br /> |<br /> ''lexA105''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:14429|CGSC:14429]]<br /> |<br /> <br /> |- <br /> |<br /> ''lexA106''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:14431|CGSC:14431]]<br /> |<br /> <br /> |- <br /> |<br /> ''lexA108''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:14439|CGSC:14439]]<br /> |<br /> <br /> |- <br /> |<br /> ''lexA71::Tn5''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:30813|CGSC:30813]]<br /> |<br /> <br /> |- <br /> |<br /> ''lexA2''<br /> |<br /> C461T<br /> |<br /> T154I<br /> |<br /> Sensitivity to<br /> |<br /> hypocleavable repressor leads to a sensitivity to DNA damage<br /> |<br /> PMID:3127383<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> spr<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:2834329<br /> PMID:7038393<br /> |<br /> <br /> |<br /> uninducible, not cleaved during SOS response <br /> |- <br /> |<br /> ''lexA264'' (Silent SalI site )<br /> |<br /> GGT-&gt;GTT<br /> |<br /> G80V<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Formic acid was used as the mutagen <br /> |- <br /> |<br /> ''lexA261'' (Silent SalI site )<br /> |<br /> GGT-&gt;GAT<br /> |<br /> G80D<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Hydroxylamine was used as the mutagen <br /> |- <br /> |<br /> ''lexA266'' (Silent SalI site )<br /> |<br /> GTG-&gt;GAG<br /> |<br /> V82E<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Formic acid was used as the mutagen <br /> |- <br /> |<br /> ''lexA265'' (Silent SalI site )<br /> |<br /> GTG-&gt;ATG<br /> |<br /> V82M<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Both formic acid and hydroxylamine were used as to mutagenize the strain. <br /> |- <br /> |<br /> ''lexA262'' (Silent SalI site )<br /> |<br /> GCT-&gt;GTT<br /> |<br /> A83V<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Hydroxylamine were used as to mutagenize the strain. <br /> |- <br /> |<br /> ''lexA267'' (Silent ''SalI'' site )<br /> |<br /> GCT-&gt;ACT<br /> |<br /> A83T<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Both hydroxylamine and hydrazine were used as to mutagenize the strain. <br /> |- <br /> |<br /> ''lexA252'' (Silent ''SalI'' site )<br /> |<br /> GCT-&gt;--<br /> |<br /> A83&amp;Delta;<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Spontaneous mutation <br /> |- <br /> |<br /> ''lexA260'' (Silent ''SalI'' site )<br /> |<br /> GCC-&gt;ACC<br /> |<br /> A84T<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Hydroxylamine was used as to mutagenize the strain. <br /> |- <br /> |<br /> ''lexA268'' (Silent ''SalI'' site )<br /> |<br /> GCC-&gt;GAC<br /> |<br /> A84D<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Formic acid was used as to mutagenize the strain. <br /> |- <br /> |<br /> ''lexA3'' (Silent ''SalI'' site )<br /> |<br /> GGT-&gt;GAT<br /> |<br /> G85D<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Hydrazine was used as to mutagenize the strain. <br /> |- <br /> |<br /> ''lexA252'' (Silent ''SalI'' site )<br /> |<br /> GAA-&gt;AAA<br /> |<br /> A95K<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Spontaneous mutation <br /> |- <br /> |<br /> ''lexA274'' (Silent ''SalI'' site )<br /> |<br /> GGC-&gt;CCC<br /> |<br /> R114P<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Formic acid was used as to mutagenize the strain. <br /> |- <br /> |<br /> ''lexA251'' (Silent SalI site )<br /> |<br /> TCG-&gt;TTG<br /> |<br /> S119L<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> This allele was produced spontaneously and using hydroxylamine. <br /> |- <br /> |<br /> ''lexA269'' (Silent ''SalI'' site )<br /> |<br /> GTC-&gt;TTC<br /> |<br /> V115F<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Formic acid was used as to mutagenize the strain. <br /> |- <br /> |<br /> ''lexA280'' (Silent ''SalI'' site )<br /> |<br /> ATG-&gt;TTG<br /> |<br /> M120L<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Formic acid was used as to mutagenize the strain. <br /> |- <br /> |<br /> ''lexA263'' (Silent SalI site )<br /> |<br /> GGG-&gt;GAG<br /> |<br /> G117E<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Both formic acid and hydroxylamine were used as to mutagenize the strain. <br /> |- <br /> |<br /> ''lexA259'' (Silent ''SalI'' site )<br /> |<br /> ACC-&gt;ATC<br /> |<br /> T154I<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Both hydrazine and hydroxylamine were used as to mutagenize the strain. <br /> |- <br /> |<br /> ''lexA270'' (Silent ''SalI'' site )<br /> |<br /> AAG-&gt;AGG<br /> |<br /> K156R<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Formic acid was used as to mutagenize the strain. <br /> |- <br /> |<br /> ''lexA272'' (Silent ''SalI'' site )<br /> |<br /> AAG-&gt;ATG<br /> |<br /> K156M<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Formic acid was used as to mutagenize the strain. <br /> |- <br /> |<br /> ''lexA271-281'' <br /> |<br /> <br /> |<br /> K156N/Q184H<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Formic acid was used as to mutagenize the strain. <br /> |- <br /> |<br /> ''lexA271'' (Silent ''SalI'' and ''BglI'' site)<br /> |<br /> AAG-&gt;AAT<br /> |<br /> K156N<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> ''lexA281'' (Silent ''SalI'' and ''BstI'' site)<br /> |<br /> CAG-&gt;CAT<br /> |<br /> Q184H<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> ''lexA273-282'' <br /> |<br /> <br /> |<br /> K156T/E184V<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> Formic acid was used as to mutagenize the strain. <br /> |- <br /> |<br /> ''lexA273'' (Silent ''SalI and BglI'' sites)<br /> |<br /> AAG-&gt;ACG<br /> |<br /> K156T<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> ''lexA282'' (Silent ''SalI and BglI'' sites)<br /> |<br /> GAA-&gt;GTA<br /> |<br /> E170V<br /> |<br /> <br /> |<br /> Ind- phenotype<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> lexA3 in [[MDS42]]<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases senstitivity to [[Bicyclomycin]]<br /> |<br /> PMID:21183718<br /> |<br /> <br /> |<br /> fig. 2<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18645.D46aa058c206f8&amp;page=18645&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18645.D46aa058c206f8--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.18645.E4e04be5d4dcbe--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;E4e04be5d4dcbe&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.18645.E4e04be5d4dcbe&amp;page=18645&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.18645.E4e04be5d4dcbe--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18645.K46aa058cdba1d--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;K46aa058cdba1d&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW4003<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCAAAGCGTTAACGGCCAGGCA<br /> <br /> Primer 2:CCaAGCCAGTCGCCGTTGCGAAT <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:1F8|1F8]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=634 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:12B4|12B4]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=635 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:1E4|1E4]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=636 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[malF:Gene|malF3089::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12164 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40371 CGSC7476]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 60% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> |- <br /> |<br /> [[yjcS:Gene|zje-2241::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18427 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40603 CGSC7481]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 9% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> |- <br /> |<br /> DM Strain List<br /> |<br /> Strain<br /> |<br /> There are several strains with single ''lexA'' mutations listed in Table 1.<br /> |<br /> PMID:4343824 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18645.K46aa058cdba1d&amp;page=18645&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18645.K46aa058cdba1d--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18645.A46aa058d892be--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;A46aa058d892be&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG10533 ECOCYC:EG10533]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG10533 EcoGene:EG10533]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=948544 GeneID:948544]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18645.A46aa058d892be&amp;page=18645&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18645.A46aa058d892be--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18645.D46a71ecf03b0b--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;D46a71ecf03b0b&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18645.D46a71ecf03b0b&amp;page=18645&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18645.D46a71ecf03b0b--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes not in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:lex genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=mfd:Gene&diff=1362163 mfd:Gene 2011-10-06T15:43:49Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|mfd}}{{Tab On|Gene|mfd}}{{Tab|Gene Product(s)|mfd}}{{Tab|Expression|mfd}}{{Tab|Evolution|mfd}}{{Tab|On One Page|mfd}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12777.B46a9bfe17d1aa--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;B46a9bfe17d1aa&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''mfd''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Mutation frequency decline<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK1100, b1114, JW1100''&lt;ref name='LIB:Riley_2006'/&gt;, JW1100''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12777.B46a9bfe17d1aa&amp;page=12777&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12777.B46a9bfe17d1aa--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12777.P46a9bfe202611--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;P46a9bfe202611&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 25.21 minutes&amp;nbsp;<br /> |<br /> MG1655: 1173187..1169741&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:1169741..1173187<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG11619 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|1168741|1174187|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|1169741|1173187|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG11619 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 1188559..1185113&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:1185113..1188559<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|1185113|1188559|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|1185113|1188559|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 1073666..1077112&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:1073666..1077112<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|1073666|1077112|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|1073666|1077112|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 1175541..1172095&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:1172095..1175541<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|1171095|1176541|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|1172095|1175541|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 1228632..1225186&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:1225186..1228632<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|1218294|1235524|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|1218294|1235524|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12777.P46a9bfe202611&amp;page=12777&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12777.P46a9bfe202611--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12777.U46a9bfe2a2866--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;U46a9bfe2a2866&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12777.U46a9bfe2a2866&amp;page=12777&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12777.U46a9bfe2a2866--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12777.D46a9bfe2e3ab1--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;D46a9bfe2e3ab1&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;mfd (Keio:JW1100)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=99635 CGSC8293]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0003763 mfd::Tn5KAN-2] (FB20256)<br /> |<br /> Insertion at nt 291 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB20256]<br /> |<br /> does not contain [[pKD46]] <br /> |- <br /> |<br /> ''mfd-1''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:28643|CGSC:28643]]<br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;mfd-739::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:99633|CGSC:99633]]<br /> |<br /> <br /> |- <br /> |<br /> mfd in [[MDS42]]<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases sensitivity to [[Bicyclomycin]]<br /> |<br /> PMID:21183718<br /> |<br /> <br /> |<br /> fig. 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12777.D46a9bfe2e3ab1&amp;page=12777&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12777.D46a9bfe2e3ab1--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.12777.O4e04bf30cf2a5--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;O4e04bf30cf2a5&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.12777.O4e04bf30cf2a5&amp;page=12777&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.12777.O4e04bf30cf2a5--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12777.Z46a9bfe38f7ab--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;Z46a9bfe38f7ab&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW1100<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCCCTGAACAATATCGTTATAC<br /> <br /> Primer 2:CCAGCGATCGCGTTCTCTTCCAG <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:15A8|15A8]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=237 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:E4C2|E4C2]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=238 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[yceG:Gene|zce-726::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12078 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39418 CGSC7361]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 60% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> |- <br /> |<br /> [[elbA:Gene|zcf-117::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18463 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39422 CGSC7363]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 17% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12777.Z46a9bfe38f7ab&amp;page=12777&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12777.Z46a9bfe38f7ab--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12777.U46a9bfe4266d5--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;U46a9bfe4266d5&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG11619 ECOCYC:EG11619]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG11619 EcoGene:EG11619]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=945681 GeneID:945681]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12777.U46a9bfe4266d5&amp;page=12777&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12777.U46a9bfe4266d5--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12777.S46a6dd56a4011--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;S46a6dd56a4011&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12777.S46a6dd56a4011&amp;page=12777&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12777.S46a6dd56a4011--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:mfd genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=nusG:Gene&diff=1362162 nusG:Gene 2011-10-06T15:41:52Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|nusG}}{{Tab On|Gene|nusG}}{{Tab|Gene Product(s)|nusG}}{{Tab|Expression|nusG}}{{Tab|Evolution|nusG}}{{Tab|On One Page|nusG}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18521.J46aa03e3b443b--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;J46aa03e3b443b&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''nusG''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> N (phage lambda protein) utilization substance<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK3973, b3982, JW3945''&lt;ref name='LIB:Riley_2006'/&gt;, JW3945''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18521.J46aa03e3b443b&amp;page=18521&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18521.J46aa03e3b443b--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18521.I46aa03e442c72--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;I46aa03e442c72&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 90 minutes&amp;nbsp;<br /> |<br /> MG1655: 4175766..4176311&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:4175766..4176311<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG10667 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|4174766|4177311|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|4175766|4176311|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG10667 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 4157354..4157899&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:4157354..4157899<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|4157354|4157899|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|4157354|4157899|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 4065446..4065991&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:4065446..4065991<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|4065446|4065991|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|4065446|4065991|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 3458938..3458393&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:3458393..3458938<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|3457393|3459938|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|3458393|3458938|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 4275462..4276007&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:4275462..4276007<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|4274372|4277097|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|4274372|4277097|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18521.I46aa03e442c72&amp;page=18521&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18521.I46aa03e442c72--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18521.N46aa03e50b5d2--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;N46aa03e50b5d2&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> |- <br /> |<br /> Coding Start (SO:0000323)<br /> |<br /> [[MG1655]]<br /> |<br /> 4175769<br /> |<br /> Edman degradation<br /> |<br /> PMID:9600841&lt;br /&gt;PMID:9740056&lt;br /&gt;<br /> |<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18521.N46aa03e50b5d2&amp;page=18521&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18521.N46aa03e50b5d2--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18521.A46aa03e556867--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;A46aa03e556867&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> nusG in [[MDS42]]<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases sensitivity to [[Bicyclomycin]]<br /> |<br /> PMID:21183718<br /> |<br /> <br /> |<br /> fig. 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18521.A46aa03e556867&amp;page=18521&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18521.A46aa03e556867--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.18521.Y4e04c0752618c--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;Y4e04c0752618c&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.18521.Y4e04c0752618c&amp;page=18521&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.18521.Y4e04c0752618c--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18521.N46aa03e626601--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;N46aa03e626601&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW3945<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCTCTGAAGCTCCTAAAAAGCG<br /> <br /> Primer 2:CCGGCTTTTTCAACCTGGCTGAA <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:E11C11|E11C11]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=534 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[argE:Gene|argE86::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12185 = [http://cgsc2.biology.yale.edu/Strain.php?ID=37153 CGSC7471]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 42% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> |- <br /> |<br /> [[thiC:Gene|thiC39::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18500 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40361 CGSC7472]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 51% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:thi-39::Tn10 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18521.N46aa03e626601&amp;page=18521&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18521.N46aa03e626601--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18521.E46aa03e6c7f6e--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;E46aa03e6c7f6e&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG10667 ECOCYC:EG10667]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG10667 EcoGene:EG10667]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=948485 GeneID:948485]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18521.E46aa03e6c7f6e&amp;page=18521&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18521.E46aa03e6c7f6e--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18521.T46a71d56b4b5c--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;T46a71d56b4b5c&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18521.T46a71d56b4b5c&amp;page=18521&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18521.T46a71d56b4b5c--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes not in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:nus genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=ruvC:Gene&diff=1362161 ruvC:Gene 2011-10-06T15:38:23Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|ruvC}}{{Tab On|Gene|ruvC}}{{Tab|Gene Product(s)|ruvC}}{{Tab|Expression|ruvC}}{{Tab|Evolution|ruvC}}{{Tab|On One Page|ruvC}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14303.S46a9d0b8a177c--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;S46a9d0b8a177c&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''ruvC''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Resistance to UV light<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK1864, b1863, JW1852''&lt;ref name='LIB:Riley_2006'/&gt;, JW1852''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14303.S46a9d0b8a177c&amp;page=14303&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14303.S46a9d0b8a177c--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14303.Q46a9d0b928f7b--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;Q46a9d0b928f7b&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 41.92 minutes&amp;nbsp;<br /> |<br /> MG1655: 1945400..1944879&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:1944879..1945400<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG10925 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|1943879|1946400|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|1944879|1945400|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG10925 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 1926146..1925625&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:1925625..1926146<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|1925625|1926146|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|1925625|1926146|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 1836938..1837459&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:1836938..1837459<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|1836938|1837459|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|1836938|1837459|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 1949090..1948569&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:1948569..1949090<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|1947569|1950090|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|1948569|1949090|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 2035971..2035450&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:2035450..2035971<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|2034408|2037013|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|2034408|2037013|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14303.Q46a9d0b928f7b&amp;page=14303&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14303.Q46a9d0b928f7b--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14303.L46a9d0b9d0282--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;L46a9d0b9d0282&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> |- <br /> |<br /> Coding Start (SO:0000323)<br /> |<br /> [[MG1655]]<br /> |<br /> 1944882<br /> |<br /> Edman degradation<br /> |<br /> PMID:1661673&lt;br /&gt;PMID:1758493&lt;br /&gt;<br /> |<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14303.L46a9d0b9d0282&amp;page=14303&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14303.L46a9d0b9d0282--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14303.P46a9d0ba1fee9--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;P46a9d0ba1fee9&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;ruvC (Keio:JW1852)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=107826 CGSC9545]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0006215 ruvC::Tn5KAN-2] (FB20479)<br /> |<br /> Insertion at nt 86 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB20479]<br /> |<br /> contains [[pKD46]] <br /> |- <br /> |<br /> ''ruvC53''<br /> |<br /> <br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> *UV Irradiation<br /> *MMC<br /> |<br /> PMID:16164551<br /> |<br /> [[cgscmutation:59109|CGSC:59109]]<br /> |<br /> <br /> |- <br /> |<br /> ''ruvC51''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:69131|CGSC:69131]]<br /> |<br /> <br /> |- <br /> |<br /> ''ruvC67::cat''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:9814711<br /> |<br /> [[cgscmutation:69142|CGSC:69142]]<br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;ruvC789::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:102856|CGSC:102856]]<br /> |<br /> <br /> |- <br /> |<br /> ''ruvC53ΔtopB''<br /> |<br /> <br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> *~20 times more sensitive to UV irradiation than the single ''ruvC53'' mutation alone.<br /> *MMC<br /> |<br /> PMID:16164551<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> ruvC in [[MDS42]]<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases sensitivity to [[Bicyclomycin]]<br /> |<br /> PMID:21183718<br /> |<br /> <br /> |<br /> fig. 2<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14303.P46a9d0ba1fee9&amp;page=14303&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14303.P46a9d0ba1fee9--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.14303.P4e04c36d2aee3--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;P4e04c36d2aee3&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.14303.P4e04c36d2aee3&amp;page=14303&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.14303.P4e04c36d2aee3--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14303.T46a9d0bac708b--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;T46a9d0bac708b&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW1852<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCGCTATTATTCTCGGCATTGA<br /> <br /> Primer 2:CCACGCAGTCGCCCTCTCGCCAG <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:20H4|20H4]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=337 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[eda:Gene|eda-51::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18486 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39983 CGSC7392]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 59% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> |- <br /> |<br /> [[uvrC:Gene|uvrC279::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12156 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39987 CGSC7394]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 13% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14303.T46a9d0bac708b&amp;page=14303&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14303.T46a9d0bac708b--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14303.G46a9d0bb642d9--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;G46a9d0bb642d9&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG10925 ECOCYC:EG10925]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG10925 EcoGene:EG10925]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=946378 GeneID:946378]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14303.G46a9d0bb642d9&amp;page=14303&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14303.G46a9d0bb642d9--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14303.U46a6ee148b0eb--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;U46a6ee148b0eb&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14303.U46a6ee148b0eb&amp;page=14303&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14303.U46a6ee148b0eb--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:ruv genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=recB:Gene&diff=1362160 recB:Gene 2011-10-06T15:36:40Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|recB}}{{Tab On|Gene|recB}}{{Tab|Gene Product(s)|recB}}{{Tab|Expression|recB}}{{Tab|Evolution|recB}}{{Tab|On One Page|recB}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16207.F46a9e70c5599e--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;F46a9e70c5599e&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''recB''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Recombination<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK2816, b2820, JW2788, rorA, ior''&lt;ref name='LIB:Riley_2006'/&gt;, ior''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.16207.F46a9e70c5599e&amp;page=16207&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16207.F46a9e70c5599e--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16207.L46a9e70cd514e--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;L46a9e70cd514e&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 63.59 minutes&amp;nbsp;<br /> |<br /> MG1655: 2954025..2950483&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:2950483..2954025<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG10824 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|2949483|2955025|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|2950483|2954025|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG10824 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 2850622..2847080&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:2847080..2850622<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|2847080|2850622|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|2847080|2850622|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 2837631..2841173&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:2837631..2841173<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|2837631|2841173|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|2837631|2841173|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 2954659..2951117&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:2951117..2954659<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|2950117|2955659|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|2951117|2954659|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 3047895..3044353&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:3044353..3047895<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|3037269|3054979|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|3037269|3054979|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.16207.L46a9e70cd514e&amp;page=16207&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16207.L46a9e70cd514e--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16207.Y46a9e70d912fc--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;Y46a9e70d912fc&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> |- <br /> |<br /> Coding Start (SO:0000323)<br /> |<br /> [[MG1655]]<br /> |<br /> 2950486<br /> |<br /> Edman degradation<br /> |<br /> PMID:1618858&lt;br /&gt;<br /> |<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.16207.Y46a9e70d912fc&amp;page=16207&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16207.Y46a9e70d912fc--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16207.L46a9e70dd82cb--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;L46a9e70dd82cb&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;recB (Keio:JW2788)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=108463 CGSC10182]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0009249 recB::Tn5KAN-I-SceI] (FB20945)<br /> |<br /> Insertion at nt 2423 in Minus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB20945]<br /> |<br /> contains [[pKD46]] <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0009249 recB::Tn5KAN-I-SceI] (FB20946)<br /> |<br /> Insertion at nt 2423 in Minus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB20946]<br /> |<br /> does not contain [[pKD46]] <br /> |- <br /> |<br /> ''recB21''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:4677|CGSC:4677]]<br /> |<br /> <br /> |- <br /> |<br /> ''recB270''(ts)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> temperature sensitive<br /> |<br /> <br /> |<br /> [[cgscmutation:8994|CGSC:8994]]<br /> |<br /> <br /> |- <br /> |<br /> ''recB1067(D1067A)''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:9790841<br /> |<br /> [[cgscmutation:71962|CGSC:71962]]<br /> |<br /> <br /> |- <br /> |<br /> ''recB1080(D1080A)''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:11532156<br /> |<br /> [[cgscmutation:72006|CGSC:72006]]<br /> |<br /> <br /> |- <br /> |<br /> ''recB1082(K1082Q)''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:9790841<br /> |<br /> [[cgscmutation:72009|CGSC:72009]]<br /> |<br /> <br /> |- <br /> |<br /> ''recB60''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:84445|CGSC:84445]]<br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;recB745::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:102622|CGSC:102622]]<br /> |<br /> <br /> |- <br /> |<br /> recB in [[MDS42]]<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases sensitivity to bicyclomycin<br /> |<br /> PMID:21183718<br /> |<br /> <br /> |<br /> fig. 2 <br /> |- <br /> |<br /> recB<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> decreases sensitivity to [[Bicyclomycin]]<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.16207.L46a9e70dd82cb&amp;page=16207&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16207.L46a9e70dd82cb--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.16207.P4e04c225d976d--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;P4e04c225d976d&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.16207.P4e04c225d976d&amp;page=16207&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.16207.P4e04c225d976d--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16207.P46a9e70e938b5--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;P46a9e70e938b5&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW2788<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCAGTGATGTCGCCGAGACACT<br /> <br /> Primer 2:CCgGCCTCCTCCAGGGTCATACC <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:10B6|10B6]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=459 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:3G11|3G11]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=460 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[fucP:Gene|fucP3072::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12079 = [http://cgsc2.biology.yale.edu/Strain.php?ID=38034 CGSC7427]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 52% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:fuc-3072::Tn10 <br /> |- <br /> |<br /> [[recD:Gene|recD1901::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12135 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40106 CGSC7429]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 99% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.16207.P46a9e70e938b5&amp;page=16207&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16207.P46a9e70e938b5--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16207.J46a9e70f37d7f--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;J46a9e70f37d7f&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG10824 ECOCYC:EG10824]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG10824 EcoGene:EG10824]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=947286 GeneID:947286]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.16207.J46a9e70f37d7f&amp;page=16207&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16207.J46a9e70f37d7f--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16207.L46a7035138a9d--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;L46a7035138a9d&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.16207.L46a7035138a9d&amp;page=16207&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.16207.L46a7035138a9d--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:rec genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=rep:Gene&diff=1362159 rep:Gene 2011-10-06T15:35:41Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|rep}}{{Tab On|Gene|rep}}{{Tab|Gene Product(s)|rep}}{{Tab|Expression|rep}}{{Tab|Evolution|rep}}{{Tab|On One Page|rep}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18115.X46a9feac3337d--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;X46a9feac3337d&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''rep''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Replicase<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK3770, b3778, JW5604, dasC, mbrA, mmrA, dasC?''&lt;ref name='LIB:Riley_2006'/&gt;&lt;ref name='LIB:EcoCyc10.6'/&gt;, mmrA?''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18115.X46a9feac3337d&amp;page=18115&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18115.X46a9feac3337d--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18115.N46a9feacb6204--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;N46a9feacb6204&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 85.32 minutes&amp;nbsp;<br /> |<br /> MG1655: 3958700..3960721&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:3958700..3960721<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG10837 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|3957700|3961721|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|3958700|3960721|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG10837 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 3922479..3924500&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:3922479..3924500<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|3922479|3924500|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|3922479|3924500|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 3848369..3850390&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:3848369..3850390<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|3848369|3850390|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|3848369|3850390|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 3676004..3673983&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:3673983..3676004<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|3672983|3677004|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|3673983|3676004|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 4057620..4059641&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:4057620..4059641<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|4053578|4063683|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|4053578|4063683|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18115.N46a9feacb6204&amp;page=18115&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18115.N46a9feacb6204--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18115.I46a9fead7adba--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;I46a9fead7adba&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> |- <br /> |<br /> Coding Start (SO:0000323)<br /> |<br /> [[MG1655]]<br /> |<br /> 3958700<br /> |<br /> Edman degradation<br /> |<br /> PMID:2999067&lt;br /&gt;<br /> |<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18115.I46a9fead7adba&amp;page=18115&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18115.I46a9fead7adba--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18115.Y46a9feadc506b--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;Y46a9feadc506b&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;rep (Keio:JW5604)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]<br /> |<br /> <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0012344 rep::Tn5KAN-I-SceI] (FB21451)<br /> |<br /> Insertion at nt 508 in Minus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB21451]<br /> |<br /> contains [[pKD46]] <br /> |- <br /> |<br /> &amp;Delta;rep::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|Acetate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;rep::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|a-Hydroxybutyrate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;rep::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|a-Ketobutyrate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;rep::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|a-Ketoglutarate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;rep::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|Succinate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;rep::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|Bromosuccinate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;rep::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|L-Alanine]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;rep::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|L-Asparagine]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;rep::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|L-Aspartate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;rep::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|L-Serine]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> ''rep-5''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:7013|CGSC:7013]]<br /> |<br /> <br /> |- <br /> |<br /> ''rep-3''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:383240<br /> |<br /> [[cgscmutation:9794|CGSC:9794]]<br /> |<br /> <br /> |- <br /> |<br /> ''rep-142''(ts)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> temperature sensitive<br /> |<br /> <br /> |<br /> [[cgscmutation:90737|CGSC:90737]]<br /> |<br /> <br /> |- <br /> |<br /> ''[rep-71]''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:6286604<br /> |<br /> [[cgscmutation:90823|CGSC:90823]]<br /> |<br /> null allele <br /> |- <br /> |<br /> ''&amp;#916;rep-729::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:113537|CGSC:113537]]<br /> |<br /> <br /> |- <br /> |<br /> rep in [[MDS42]]<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increased sensitivity to [[Bicyclomycin]]<br /> |<br /> PMID:21183718<br /> |<br /> <br /> |<br /> Fig. 2 <br /> |- <br /> |<br /> mbrA4<br /> |<br /> <br /> |<br /> <br /> |<br /> Growth Phenotype<br /> |<br /> no growth in the first few hours at non-permissive conditions but eventually resumed growth, after exposed to LB cells began to elongate<br /> LB-Mac-<br /> |<br /> PMID:2176633<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> mbrA15<br /> |<br /> <br /> |<br /> <br /> |<br /> Growth Phenotype<br /> |<br /> temperature sensitive, forms two distinct populations, one more dense and one less dense than wild type<br /> |<br /> PMID:2176633<br /> |<br /> <br /> |<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18115.Y46a9feadc506b&amp;page=18115&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18115.Y46a9feadc506b--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.18115.G4e04c23ae6338--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;G4e04c23ae6338&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.18115.G4e04c23ae6338&amp;page=18115&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.18115.G4e04c23ae6338--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18115.D46a9feae893d7--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;D46a9feae893d7&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW5604<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:cloned as old JW<br /> <br /> Primer 1:GCCCGTCTAAACCCCGGCCAACA<br /> <br /> Primer 2:CCTTTCCCTCGTTTTGCCGCCAT <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:2A8|2A8]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=556 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:2E6|2E6]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=557 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[ilvD:Gene|ilvD500::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18431 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40338 CGSC7462]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 83% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:ilv500::Tn10 <br /> |- <br /> |<br /> metEo-3079::Tn10<br /> |<br /> Linked marker<br /> |<br /> CAG18491 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40350 CGSC7464]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 10% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:metE3079::Tn10 nnnThe Tn10 in CAG13491 is inserted in the metE regulatory region, but causes a Met- phenotype. <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18115.D46a9feae893d7&amp;page=18115&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18115.D46a9feae893d7--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18115.J46a9feaf34a80--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;J46a9feaf34a80&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG10837 ECOCYC:EG10837]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG10837 EcoGene:EG10837]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=948292 GeneID:948292]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18115.J46a9feaf34a80&amp;page=18115&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18115.J46a9feaf34a80--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18115.G46a718b356745--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;G46a718b356745&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18115.G46a718b356745&amp;page=18115&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18115.G46a718b356745--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:rep genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=priA:Gene&diff=1362158 priA:Gene 2011-10-06T15:34:11Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|priA}}{{Tab On|Gene|priA}}{{Tab|Gene Product(s)|priA}}{{Tab|Expression|priA}}{{Tab|Evolution|priA}}{{Tab|On One Page|priA}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18429.N46aa02afd59bb--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;N46aa02afd59bb&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''priA''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Primosome<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK3927, b3935, JW3906, srgA''&lt;ref name='LIB:Riley_2006'/&gt;, srgA''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18429.N46aa02afd59bb&amp;page=18429&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18429.N46aa02afd59bb--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18429.H46aa02b0641a1--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;H46aa02b0641a1&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 88.86 minutes&amp;nbsp;<br /> |<br /> MG1655: 4124833..4122635&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:4122635..4124833<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG10763 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|4121635|4125833|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|4122635|4124833|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG10763 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 4106293..4104095&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:4104095..4106293<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|4104095|4106293|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|4104095|4106293|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 4012304..4014502&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:4012304..4014502<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|4012304|4014502|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|4012304|4014502|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 3509871..3512069&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:3509871..3512069<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|3508871|3513069|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|3509871|3512069|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 4224530..4222332&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:4222332..4224530<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|4217936|4228926|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|4217936|4228926|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18429.H46aa02b0641a1&amp;page=18429&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18429.H46aa02b0641a1--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18429.B46aa02b12a2b1--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;B46aa02b12a2b1&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> |- <br /> |<br /> Coding Start (SO:0000323)<br /> |<br /> [[MG1655]]<br /> |<br /> 4122635<br /> |<br /> Edman degradation<br /> |<br /> PMID:2162049&lt;br /&gt;PMID:2162050&lt;br /&gt;<br /> |<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18429.B46aa02b12a2b1&amp;page=18429&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18429.B46aa02b12a2b1--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18429.R46aa02b174f09--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;R46aa02b174f09&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;priA (Keio:JW3906)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=109101 CGSC10820]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> ''priA1::KanR''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> *reduced P1 transduction frequency<br /> *chronic expression of ''sulA'' gene<br /> *defective in transductional recombination<br /> *defective in conjugative recombination<br /> *hypersensitive to mitomycin C<br /> *hypersensitive to gamma rays<br /> |<br /> PMID:1938875 PMID:10713144 PMID:8631700<br /> |<br /> [[cgscmutation:27573|CGSC:27573]]<br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;priA722::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:102454|CGSC:102454]]<br /> |<br /> <br /> |- <br /> |<br /> ''priA2::kan''<br /> |<br /> inserted ''kan'' gene fragment<br /> |<br /> <br /> |<br /> <br /> |<br /> *reduced P1 transduction frequency<br /> *chronic expression of ''sulA'' gene<br /> *defective in transductional recombination<br /> *defective in conjugative recombination<br /> *hypersensitive to mitomycin C<br /> *hypersensitive to gamma rays<br /> |<br /> PMID:8631700<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> ''priA2::kan ftsK&lt;sub&gt;C&lt;/sub&gt;''<br /> |<br /> <br /> |<br /> <br /> |<br /> Growth Phenotype<br /> |<br /> synthetically lethal<br /> |<br /> PMID:11459954<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> priA in [[MDS42]]<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases sensitivity to [[Bicyclomycin]]<br /> |<br /> PMID:21183718<br /> |<br /> <br /> |<br /> fig. 2<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18429.R46aa02b174f09&amp;page=18429&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18429.R46aa02b174f09--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> ''spa-47'' (''dnaC'') suppresses the recombination and DSB repair defects seen in the ''priA1::kan'' mutant &lt;ref name='PMID:8631700'/&gt;<br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.18429.Z4e04c1720fca8--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;Z4e04c1720fca8&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.18429.Z4e04c1720fca8&amp;page=18429&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.18429.Z4e04c1720fca8--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18429.J46aa02b23a725--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;J46aa02b23a725&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW3906<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCCCCGTTGCCCACGTTGCCTT<br /> <br /> Primer 2:CCACCCTCAATCGGATCAACATC <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:12E3|12E3]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=538 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:4H12|4H12]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=539 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[yihO:Gene|zih-35::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18495 = [http://cgsc2.biology.yale.edu/Strain.php?ID=37140 CGSC7467]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 5% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> |- <br /> |<br /> [[pflD:Gene|pflD501::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18477 = [http://cgsc2.biology.yale.edu/Strain.php?ID=37152 CGSC7470]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 47% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zij-501::Tn10 nnnCAG18477 also carries metF79(Am) (CGSC). <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18429.J46aa02b23a725&amp;page=18429&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18429.J46aa02b23a725--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18429.C46aa02b2dafbf--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;C46aa02b2dafbf&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG10763 ECOCYC:EG10763]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG10763 EcoGene:EG10763]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=948426 GeneID:948426]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18429.C46aa02b2dafbf&amp;page=18429&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18429.C46aa02b2dafbf--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18429.I46a71c44c0fc2--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;I46a71c44c0fc2&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.18429.I46a71c44c0fc2&amp;page=18429&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.18429.I46a71c44c0fc2--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:pri genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=recA:Gene&diff=1362157 recA:Gene 2011-10-06T15:33:10Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|recA}}{{Tab On|Gene|recA}}{{Tab|Gene Product(s)|recA}}{{Tab|Expression|recA}}{{Tab|Evolution|recA}}{{Tab|On One Page|recA}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.P46a9e41357afd--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| {{Prettytable}} id=&quot;P46a9e41357afd&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''recA''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Recombination<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK2694, b2699, JW2669, lexB, srf, umuB, zab, recH, rnmB, tif, umuR''&lt;ref name='LIB:Riley_2006'/&gt;, umuR''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15963.P46a9e41357afd&amp;page=15963&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.P46a9e41357afd--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.D46a9e413d7208--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;D46a9e413d7208&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 60.8 minutes&amp;nbsp;<br /> |<br /> MG1655: 2821791..2820730&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:2820730..2821791<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG10823 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|2819730|2822791|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|2820730|2821791|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG10823 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 2718628..2717567&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:2717567..2718628<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|2717567|2718628|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|2717567|2718628|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 2706542..2707603&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:2706542..2707603<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|2706542|2707603|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|2706542|2707603|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 2822425..2821364&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:2821364..2822425<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|2820364|2823425|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|2821364|2822425|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15963.D46a9e413d7208&amp;page=15963&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.D46a9e413d7208--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.M46a9e41491853--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;M46a9e41491853&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> |- <br /> |<br /> Coding Start (SO:0000323)<br /> |<br /> [[MG1655]]<br /> |<br /> 2820733<br /> |<br /> Edman degradation<br /> |<br /> PMID:6244554&lt;br /&gt;PMID:6930655&lt;br /&gt;<br /> |<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15963.M46a9e41491853&amp;page=15963&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.M46a9e41491853--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.Z46a9e414d7fcb--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;Z46a9e414d7fcb&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> Strain DH10B<br /> |<br /> <br /> |<br /> G161D<br /> |<br /> <br /> |<br /> Nonsynonomous mutation<br /> |<br /> PMID:18245285<br /> |<br /> [https://asap.ahabs.wisc.edu/asap/home.php ASAP]<br /> |<br /> This is a SNP in &lt;i&gt;E. coli&lt;/i&gt; K-12 Strain [[DH10B]] <br /> |- <br /> |<br /> &amp;Delta;recA (Keio:JW2669)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=108386 CGSC10105]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0008876 recA::Tn5KAN-I-SceI] (FB20884)<br /> |<br /> Insertion at nt 407 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB20884]<br /> |<br /> does not contain [[pKD46]] <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0008876 recA::Tn5KAN-I-SceI] (FB20885)<br /> |<br /> Insertion at nt 407 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB20885]<br /> |<br /> contains [[pKD46]] <br /> |- <br /> |<br /> &amp;Delta;recA::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|a-Ketoglutarate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;recA::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|Succinate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;recA::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|L-Asparagine]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> ''recA938::Tn9-200''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:4556|CGSC:4556]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA1''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:6363880 PMID:350827<br /> |<br /> [[cgscmutation:4691|CGSC:4691]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA56''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:2651400<br /> |<br /> [[cgscmutation:4795|CGSC:4795]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA13''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:2651400<br /> |<br /> [[cgscmutation:4897|CGSC:4897]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA44''(ts)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> temperature sensitive<br /> |<br /> PMID:2651400<br /> |<br /> [[cgscmutation:5323|CGSC:5323]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA41''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:5549|CGSC:5549]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA441''(ts)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> temperature sensitive<br /> |<br /> PMID:6363880 PMID:2406267 PMID:350827<br /> |<br /> [[cgscmutation:6585|CGSC:6585]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA430''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:6363880 PMID:2651400 PMID:1400177<br /> |<br /> [[cgscmutation:6772|CGSC:6772]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA3''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:6961|CGSC:6961]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA11''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:7512687 PMID:5321955 PMID:350827<br /> |<br /> [[cgscmutation:7623|CGSC:7623]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA200''(ts)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> temperature sensitive<br /> |<br /> <br /> |<br /> [[cgscmutation:8413|CGSC:8413]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA14''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:9230|CGSC:9230]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA12''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:7512687 PMID:350827<br /> |<br /> [[cgscmutation:9257|CGSC:9257]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA431''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:9898|CGSC:9898]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA34''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:9900|CGSC:9900]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA99''(Am)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:350827 PMID:2651400<br /> |<br /> [[cgscmutation:10336|CGSC:10336]]<br /> |<br /> amber (UAG) mutation <br /> |- <br /> |<br /> ''recA142''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:2651400<br /> |<br /> [[cgscmutation:11217|CGSC:11217]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA111''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:14572|CGSC:14572]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA629''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:6088537<br /> |<br /> [[cgscmutation:19643|CGSC:19643]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA2111::RP4-2Tc::Mu''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:60624|CGSC:60624]]<br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;recA635::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:10829079<br /> |<br /> [[cgscmutation:64884|CGSC:64884]]<br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;recA636''(del-ins)''::FRT''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:10829079<br /> |<br /> [[cgscmutation:65682|CGSC:65682]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA2''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:72687|CGSC:72687]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA1907::cat-aadA''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:2155195<br /> |<br /> [[cgscmutation:99541|CGSC:99541]]<br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;recA774::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:102620|CGSC:102620]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA730''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> constitutively activated form of RecA so it cleaves the LexA repressor in the absence of SOS induction<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> recA<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increased sensitivity to [[Bicyclomycin]]<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15963.Z46a9e414d7fcb&amp;page=15963&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.Z46a9e414d7fcb--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.15963.L4e04c223a1fb7--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;L4e04c223a1fb7&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.15963.L4e04c223a1fb7&amp;page=15963&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.15963.L4e04c223a1fb7--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.K46a9e41592a09--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;K46a9e41592a09&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW2669<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCGCTATCGACGAAAACAAACA<br /> <br /> Primer 2:CCAAAATCTTCGTTAGTTTCTGC <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:23B7|23B7]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=446 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[pheA:Gene|pheA18::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12158 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40091 CGSC7421]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: % &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> |- <br /> |<br /> [[srlD:Gene|srlD3131::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18642 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40097 CGSC7423]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 85% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zfh-3131::Tn10, zfi-3131::Tn10 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15963.K46a9e41592a09&amp;page=15963&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.K46a9e41592a09--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.C46a9e416363d0--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;C46a9e416363d0&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG10823 ECOCYC:EG10823]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG10823 EcoGene:EG10823]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=947170 GeneID:947170]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15963.C46a9e416363d0&amp;page=15963&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.C46a9e416363d0--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.F46a9e419b5f8a--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;F46a9e419b5f8a&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15963.F46a9e419b5f8a&amp;page=15963&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.F46a9e419b5f8a--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:rec genes]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=recA:Gene&diff=1362156 recA:Gene 2011-10-06T15:28:25Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|recA}}{{Tab On|Gene|recA}}{{Tab|Gene Product(s)|recA}}{{Tab|Expression|recA}}{{Tab|Evolution|recA}}{{Tab|On One Page|recA}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.P46a9e41357afd--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| {{Prettytable}} id=&quot;P46a9e41357afd&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''recA''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Recombination<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK2694, b2699, JW2669, lexB, srf, umuB, zab, recH, rnmB, tif, umuR''&lt;ref name='LIB:Riley_2006'/&gt;, umuR''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15963.P46a9e41357afd&amp;page=15963&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.P46a9e41357afd--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.D46a9e413d7208--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;D46a9e413d7208&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 60.8 minutes&amp;nbsp;<br /> |<br /> MG1655: 2821791..2820730&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:2820730..2821791<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG10823 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|2819730|2822791|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|2820730|2821791|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG10823 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 2718628..2717567&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:2717567..2718628<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|2717567|2718628|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|2717567|2718628|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 2706542..2707603&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:2706542..2707603<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|2706542|2707603|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|2706542|2707603|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 2822425..2821364&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:2821364..2822425<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|2820364|2823425|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|2821364|2822425|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15963.D46a9e413d7208&amp;page=15963&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.D46a9e413d7208--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.M46a9e41491853--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;M46a9e41491853&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> |- <br /> |<br /> Coding Start (SO:0000323)<br /> |<br /> [[MG1655]]<br /> |<br /> 2820733<br /> |<br /> Edman degradation<br /> |<br /> PMID:6244554&lt;br /&gt;PMID:6930655&lt;br /&gt;<br /> |<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15963.M46a9e41491853&amp;page=15963&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.M46a9e41491853--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.Z46a9e414d7fcb--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;Z46a9e414d7fcb&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> Strain DH10B<br /> |<br /> <br /> |<br /> G161D<br /> |<br /> <br /> |<br /> Nonsynonomous mutation<br /> |<br /> PMID:18245285<br /> |<br /> [https://asap.ahabs.wisc.edu/asap/home.php ASAP]<br /> |<br /> This is a SNP in &lt;i&gt;E. coli&lt;/i&gt; K-12 Strain [[DH10B]] <br /> |- <br /> |<br /> &amp;Delta;recA (Keio:JW2669)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=108386 CGSC10105]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0008876 recA::Tn5KAN-I-SceI] (FB20884)<br /> |<br /> Insertion at nt 407 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB20884]<br /> |<br /> does not contain [[pKD46]] <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0008876 recA::Tn5KAN-I-SceI] (FB20885)<br /> |<br /> Insertion at nt 407 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB20885]<br /> |<br /> contains [[pKD46]] <br /> |- <br /> |<br /> &amp;Delta;recA::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|a-Ketoglutarate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;recA::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|Succinate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;recA::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|L-Asparagine]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> ''recA938::Tn9-200''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:4556|CGSC:4556]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA1''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:6363880 PMID:350827<br /> |<br /> [[cgscmutation:4691|CGSC:4691]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA56''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:2651400<br /> |<br /> [[cgscmutation:4795|CGSC:4795]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA13''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:2651400<br /> |<br /> [[cgscmutation:4897|CGSC:4897]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA44''(ts)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> temperature sensitive<br /> |<br /> PMID:2651400<br /> |<br /> [[cgscmutation:5323|CGSC:5323]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA41''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:5549|CGSC:5549]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA441''(ts)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> temperature sensitive<br /> |<br /> PMID:6363880 PMID:2406267 PMID:350827<br /> |<br /> [[cgscmutation:6585|CGSC:6585]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA430''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:6363880 PMID:2651400 PMID:1400177<br /> |<br /> [[cgscmutation:6772|CGSC:6772]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA3''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:6961|CGSC:6961]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA11''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:7512687 PMID:5321955 PMID:350827<br /> |<br /> [[cgscmutation:7623|CGSC:7623]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA200''(ts)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> temperature sensitive<br /> |<br /> <br /> |<br /> [[cgscmutation:8413|CGSC:8413]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA14''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:9230|CGSC:9230]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA12''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:7512687 PMID:350827<br /> |<br /> [[cgscmutation:9257|CGSC:9257]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA431''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:9898|CGSC:9898]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA34''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:9900|CGSC:9900]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA99''(Am)<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:350827 PMID:2651400<br /> |<br /> [[cgscmutation:10336|CGSC:10336]]<br /> |<br /> amber (UAG) mutation <br /> |- <br /> |<br /> ''recA142''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:2651400<br /> |<br /> [[cgscmutation:11217|CGSC:11217]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA111''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:14572|CGSC:14572]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA629''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:6088537<br /> |<br /> [[cgscmutation:19643|CGSC:19643]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA2111::RP4-2Tc::Mu''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:60624|CGSC:60624]]<br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;recA635::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:10829079<br /> |<br /> [[cgscmutation:64884|CGSC:64884]]<br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;recA636''(del-ins)''::FRT''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:10829079<br /> |<br /> [[cgscmutation:65682|CGSC:65682]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA2''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:72687|CGSC:72687]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA1907::cat-aadA''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:2155195<br /> |<br /> [[cgscmutation:99541|CGSC:99541]]<br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;recA774::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:102620|CGSC:102620]]<br /> |<br /> <br /> |- <br /> |<br /> ''recA730''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> constitutively activated form of RecA so it cleaves the LexA repressor in the absence of SOS induction<br /> |<br /> PMID:2834329<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> recA<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increased sensitivity to [[bicyclomycin]]<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15963.Z46a9e414d7fcb&amp;page=15963&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.Z46a9e414d7fcb--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.15963.L4e04c223a1fb7--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;L4e04c223a1fb7&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.15963.L4e04c223a1fb7&amp;page=15963&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.15963.L4e04c223a1fb7--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.K46a9e41592a09--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;K46a9e41592a09&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW2669<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCGCTATCGACGAAAACAAACA<br /> <br /> Primer 2:CCAAAATCTTCGTTAGTTTCTGC <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:23B7|23B7]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=446 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[pheA:Gene|pheA18::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12158 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40091 CGSC7421]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: % &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> |- <br /> |<br /> [[srlD:Gene|srlD3131::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18642 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40097 CGSC7423]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 85% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zfh-3131::Tn10, zfi-3131::Tn10 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15963.K46a9e41592a09&amp;page=15963&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.K46a9e41592a09--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.C46a9e416363d0--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;C46a9e416363d0&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG10823 ECOCYC:EG10823]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG10823 EcoGene:EG10823]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=947170 GeneID:947170]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15963.C46a9e416363d0&amp;page=15963&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.C46a9e416363d0--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.F46a9e419b5f8a--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;F46a9e419b5f8a&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15963.F46a9e419b5f8a&amp;page=15963&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15963.F46a9e419b5f8a--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:rec genes]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=croE:Gene&diff=1362155 croE:Gene 2011-10-06T15:25:15Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|croE}}{{Tab On|Gene|croE}}{{Tab|Gene Product(s)|croE}}{{Tab|Expression|croE}}{{Tab|Evolution|croE}}{{Tab|On One Page|croE}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12841.T46a9c093727f2--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;T46a9c093727f2&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''croE''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> <br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK1132, b1146, JW5169'', ymfT&lt;ref name='LIB:Riley_2006'/&gt;, ECK4469, JW5169, ymfT''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12841.T46a9c093727f2&amp;page=12841&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12841.T46a9c093727f2--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12841.A46a9c093ebafb--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;A46a9c093ebafb&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 25.91 minutes&amp;nbsp;<br /> |<br /> MG1655: 1202247..1202447&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:1202247..1202447<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=G6590 EcoCyc]<br /> {{GBrowseLink|ecoli|NC_000913|1201247|1203447|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|ecoli|NC_000913|1202247|1202447|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=G6590 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 1204601..1204801&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:1204601..1204801<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|ecoli_W3110|AC_000091|1203601|1205801|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|ecoli_W3110|AC_000091|1204601|1204801|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12841.A46a9c093ebafb&amp;page=12841&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12841.A46a9c093ebafb--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12841.S46a9c09497ba9--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;S46a9c09497ba9&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12841.S46a9c09497ba9&amp;page=12841&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12841.S46a9c09497ba9--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12841.H46a9c094d8eca--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;H46a9c094d8eca&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;ymfT (Keio:JW5169)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=109499 CGSC11218]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;ymfT734::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:105744|CGSC:105744]]<br /> |<br /> <br /> |- <br /> |<br /> ymfT<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases sensitivity to bicyclomycin<br /> <br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12841.H46a9c094d8eca&amp;page=12841&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12841.H46a9c094d8eca--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.12841.Z4e04b9062170f--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;Z4e04b9062170f&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.12841.Z4e04b9062170f&amp;page=12841&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.12841.Z4e04b9062170f--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12841.M46a9c095850e2--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;M46a9c095850e2&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW5169<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCAAAGCGTATTGGGACTCTTT<br /> <br /> Primer 2:CCATCTTTCGGATAGATATCCGG <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:2E7|2E7]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=240 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:3E11|3E11]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=241 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[yceG:Gene|zce-726::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12078 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39418 CGSC7361]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 12% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> |- <br /> |<br /> [[elbA:Gene|zcf-117::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18463 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39422 CGSC7363]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 74% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12841.M46a9c095850e2&amp;page=12841&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12841.M46a9c095850e2--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12841.Z46a9c0961c69a--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;Z46a9c0961c69a&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]]) <br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=G6590 EcoCyc:G6590]<br /> |<br /> <br /> |- <br /> |<br /> [http://www.ecoli-york.org EchoBASE] ([[EchoBASE|EcoliWiki Page]]) <br /> |<br /> [http://www.york.ac.uk/res/thomas/Gene.cfm?recordID=EB4333 EchoBASE:EB4333]<br /> |<br /> <br /> |- <br /> |<br /> [http://chase.ou.edu/oubcf/index.php EcoliGenExpDB] ([[EcoliGenExpDB|EcoliWiki Page]]) <br /> |<br /> [http://chase.ou.edu/macro/searchlink.php?bnum=b1146 EcoliGenExpDB:b1146]<br /> |<br /> <br /> |- <br /> |<br /> [https://asap.ahabs.wisc.edu/asap/logon.php ASAP] ([[ASAP|EcoliWikiPage]])<br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?LocationID=WIS&amp;FeatureID=0003856&amp;formSubmitReturn=1 ASAP:ABE-0003856]<br /> |<br /> <br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=G6590 ECOCYC:G6590]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG14414 EcoGene:EG14414]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=945720 GeneID:945720]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12841.Z46a9c0961c69a&amp;page=12841&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12841.Z46a9c0961c69a--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12841.F46a6de0815e0d--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;F46a6de0815e0d&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12841.F46a6de0815e0d&amp;page=12841&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12841.F46a6de0815e0d--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:Gene List:e14 prophage]]<br /> [[Category:ymf genes]]<br /> [[Category:y genes]]<br /> [[Category:y genes]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=ydfC:Gene&diff=1362154 ydfC:Gene 2011-10-06T15:24:07Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|ydfC}}{{Tab On|Gene|ydfC}}{{Tab|Gene Product(s)|ydfC}}{{Tab|Expression|ydfC}}{{Tab|Evolution|ydfC}}{{Tab|On One Page|ydfC}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.I46a9c9f1bb5ae--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;I46a9c9f1bb5ae&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''ydfC''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Rz protein<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ydfC, ECK1567, b1573, JW1565'', rzpQ&lt;ref name='LIB:Riley_2006'/&gt;&lt;ref name='LIB:EcoCyc10.6'/&gt;, ECK1547, JW1545, Rz, ydfP, b1553, JW1565''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13711.I46a9c9f1bb5ae&amp;page=13711&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.I46a9c9f1bb5ae--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.L46a9c9f241e6f--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;L46a9c9f241e6f&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 35.49 minutes&amp;nbsp;<br /> |<br /> MG1655: 1646847..1647065&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:1646847..1647065<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG11302 EcoCyc]<br /> {{GBrowseLink|ecoli|NC_000913|1645847|1648065|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|ecoli|NC_000913|1646847|1647065|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG11302 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 1611224..1611721&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:1611224..1611721<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|1611224|1611721|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|1611224|1611721|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 1529113..1529610&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:1529113..1529610<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|012759|1529113|NC_1529610|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|012759|1529113|NC_1529610|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 1650537..1650755&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:1650537..1650755<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|ecoli_W3110|AC_000091|1649537|1651755|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|ecoli_W3110|AC_000091|1650537|1650755|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13711.L46a9c9f241e6f&amp;page=13711&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.L46a9c9f241e6f--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.R46a9c9f2e62f1--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;R46a9c9f2e62f1&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13711.R46a9c9f2e62f1&amp;page=13711&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.R46a9c9f2e62f1--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.J46a9c9f3349b4--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;J46a9c9f3349b4&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0005255 ydfC::Tn5KAN-I-SceI] (FB20370)<br /> |<br /> Insertion at nt 166 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB20371]<br /> |<br /> contains [[pKD46]] <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0005255 ydfC::Tn5KAN-I-SceI] (FB20370)<br /> |<br /> Insertion at nt 166 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB20372]<br /> |<br /> does not contain [[pKD46]] <br /> |- <br /> |<br /> ''&amp;#916;rzpQ722::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:106338|CGSC:106338]]<br /> |<br /> <br /> |- <br /> |<br /> rzpQ<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases senstivity to bicyclomycin<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13711.J46a9c9f3349b4&amp;page=13711&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.J46a9c9f3349b4--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.13711.G4e04c7c5bb247--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;G4e04c7c5bb247&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.13711.G4e04c7c5bb247&amp;page=13711&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.13711.G4e04c7c5bb247--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.Z46a9c9f3d941a--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;Z46a9c9f3d941a&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> <br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:<br /> <br /> Primer 1:<br /> <br /> Primer 2: <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:12E2|12E2]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=308 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:7B6|7B6]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=309 Genobase]<br /> |<br /> PMID:3038334 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13711.Z46a9c9f3d941a&amp;page=13711&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.Z46a9c9f3d941a--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.P46a9c9f473e85--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;P46a9c9f473e85&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]]) <br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG11302 EcoCyc:EG11302]<br /> |<br /> <br /> |- <br /> |<br /> [http://www.ecoli-york.org EchoBASE] ([[EchoBASE|EcoliWiki Page]]) <br /> |<br /> [http://www.york.ac.uk/res/thomas/Gene.cfm?recordID=EB1279 EchoBASE:EB1279]<br /> |<br /> <br /> |- <br /> |<br /> [http://chase.ou.edu/oubcf/index.php EcoliGenExpDB] ([[EcoliGenExpDB|EcoliWiki Page]]) <br /> |<br /> [http://chase.ou.edu/macro/searchlink.php?bnum=b1573 EcoliGenExpDB:b1573]<br /> |<br /> <br /> |- <br /> |<br /> [http://BioCyc.org/ECOL199310/ ECOL199310CYC] ([[ECOL199310CYC|EcoliWiki Page]]) <br /> |<br /> [http://BioCyc.org/ECOL199310/new-image?object=C1407 ECOL199310CYC:C1407]<br /> |<br /> <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]]) <br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG11302 EcoGene:EG11302]<br /> |<br /> <br /> |- <br /> |<br /> [http://BioCyc.org/ECOO157/ ECOO157CYC] ([[ECOO157CYC|EcoliWiki Page]]) <br /> |<br /> [http://BioCyc.org/ECOO157/new-image?object=Z6076 ECOO157CYC:Z6076]<br /> |<br /> <br /> |- <br /> |<br /> [https://asap.ahabs.wisc.edu/asap/logon.php ASAP] ([[ASAP|EcoliWikiPage]])<br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?LocationID=WIS&amp;FeatureID=0005255&amp;formSubmitReturn=1 ASAP:ABE-0005255]<br /> |<br /> <br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=G6826 ECOCYC:G6826]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG13828 EcoGene:EG13828]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=946101 GeneID:946101]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG11302 ECOCYC:EG11302]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=946107 GeneID:946107]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13711.P46a9c9f473e85&amp;page=13711&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.P46a9c9f473e85--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.U46a6e75dc2e3a--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;U46a6e75dc2e3a&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13711.U46a6e75dc2e3a&amp;page=13711&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.U46a6e75dc2e3a--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes not in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:Gene List:Qin prophage]]<br /> [[Category:rzp genes]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=ydfC:Gene&diff=1362153 ydfC:Gene 2011-10-06T15:23:39Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|ydfC}}{{Tab On|Gene|ydfC}}{{Tab|Gene Product(s)|ydfC}}{{Tab|Expression|ydfC}}{{Tab|Evolution|ydfC}}{{Tab|On One Page|ydfC}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.I46a9c9f1bb5ae--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;I46a9c9f1bb5ae&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''ydfC''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Rz protein<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ydfC, ECK1567, b1573, JW1565'', rzpQ&lt;ref name='LIB:Riley_2006'/&gt;&lt;ref name='LIB:EcoCyc10.6'/&gt;, ECK1547, JW1545, Rz, ydfP, b1553, JW1565''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13711.I46a9c9f1bb5ae&amp;page=13711&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.I46a9c9f1bb5ae--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.L46a9c9f241e6f--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;L46a9c9f241e6f&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 35.49 minutes&amp;nbsp;<br /> |<br /> MG1655: 1646847..1647065&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:1646847..1647065<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG11302 EcoCyc]<br /> {{GBrowseLink|ecoli|NC_000913|1645847|1648065|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|ecoli|NC_000913|1646847|1647065|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG11302 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 1611224..1611721&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:1611224..1611721<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|1611224|1611721|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|1611224|1611721|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 1529113..1529610&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:1529113..1529610<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|012759|1529113|NC_1529610|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|012759|1529113|NC_1529610|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 1650537..1650755&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:1650537..1650755<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|ecoli_W3110|AC_000091|1649537|1651755|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|ecoli_W3110|AC_000091|1650537|1650755|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13711.L46a9c9f241e6f&amp;page=13711&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.L46a9c9f241e6f--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.R46a9c9f2e62f1--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;R46a9c9f2e62f1&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13711.R46a9c9f2e62f1&amp;page=13711&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.R46a9c9f2e62f1--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.J46a9c9f3349b4--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;J46a9c9f3349b4&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0005255 ydfC::Tn5KAN-I-SceI] (FB20370)<br /> |<br /> Insertion at nt 166 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB20371]<br /> |<br /> contains [[pKD46]] <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0005255 ydfC::Tn5KAN-I-SceI] (FB20370)<br /> |<br /> Insertion at nt 166 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB20372]<br /> |<br /> does not contain [[pKD46]] <br /> |- <br /> |<br /> ''&amp;#916;rzpQ722::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:106338|CGSC:106338]]<br /> |<br /> <br /> |- <br /> |<br /> rzpQ<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Resistant to<br /> |<br /> increases senstivity to bicyclomycin<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13711.J46a9c9f3349b4&amp;page=13711&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.J46a9c9f3349b4--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.13711.G4e04c7c5bb247--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;G4e04c7c5bb247&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.13711.G4e04c7c5bb247&amp;page=13711&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.13711.G4e04c7c5bb247--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.Z46a9c9f3d941a--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;Z46a9c9f3d941a&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> <br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:<br /> <br /> Primer 1:<br /> <br /> Primer 2: <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:12E2|12E2]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=308 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:7B6|7B6]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=309 Genobase]<br /> |<br /> PMID:3038334 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13711.Z46a9c9f3d941a&amp;page=13711&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.Z46a9c9f3d941a--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.P46a9c9f473e85--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;P46a9c9f473e85&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]]) <br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG11302 EcoCyc:EG11302]<br /> |<br /> <br /> |- <br /> |<br /> [http://www.ecoli-york.org EchoBASE] ([[EchoBASE|EcoliWiki Page]]) <br /> |<br /> [http://www.york.ac.uk/res/thomas/Gene.cfm?recordID=EB1279 EchoBASE:EB1279]<br /> |<br /> <br /> |- <br /> |<br /> [http://chase.ou.edu/oubcf/index.php EcoliGenExpDB] ([[EcoliGenExpDB|EcoliWiki Page]]) <br /> |<br /> [http://chase.ou.edu/macro/searchlink.php?bnum=b1573 EcoliGenExpDB:b1573]<br /> |<br /> <br /> |- <br /> |<br /> [http://BioCyc.org/ECOL199310/ ECOL199310CYC] ([[ECOL199310CYC|EcoliWiki Page]]) <br /> |<br /> [http://BioCyc.org/ECOL199310/new-image?object=C1407 ECOL199310CYC:C1407]<br /> |<br /> <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]]) <br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG11302 EcoGene:EG11302]<br /> |<br /> <br /> |- <br /> |<br /> [http://BioCyc.org/ECOO157/ ECOO157CYC] ([[ECOO157CYC|EcoliWiki Page]]) <br /> |<br /> [http://BioCyc.org/ECOO157/new-image?object=Z6076 ECOO157CYC:Z6076]<br /> |<br /> <br /> |- <br /> |<br /> [https://asap.ahabs.wisc.edu/asap/logon.php ASAP] ([[ASAP|EcoliWikiPage]])<br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?LocationID=WIS&amp;FeatureID=0005255&amp;formSubmitReturn=1 ASAP:ABE-0005255]<br /> |<br /> <br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=G6826 ECOCYC:G6826]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG13828 EcoGene:EG13828]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=946101 GeneID:946101]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG11302 ECOCYC:EG11302]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=946107 GeneID:946107]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13711.P46a9c9f473e85&amp;page=13711&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.P46a9c9f473e85--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.U46a6e75dc2e3a--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;U46a6e75dc2e3a&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13711.U46a6e75dc2e3a&amp;page=13711&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13711.U46a6e75dc2e3a--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes not in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:Gene List:Qin prophage]]<br /> [[Category:rzp genes]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1362152 Bicyclomycin 2011-10-06T15:18:47Z <p>Denham: </p> <hr /> <div>Bicyclomycin, discovered in 1972, has a structure that is unique among antibiotics. Currently used to treat nonspecific diarrhea, it has a low toxicity, and no cross-resistance with other antibiotics has yet been found. It is effective against many Gram-negative bacteria.<br /> &lt;ref name='PMID:16181146'/&gt;<br /> <br /> <br /> ===Mode of Action===<br /> Bicyclomycin inhibits Rho by being a reversible, noncompetitive inhibitor of ATP.<br /> &lt;ref name='PMID:16181146'/&gt;<br /> <br /> ===Structure===<br /> <br /> ===Targets===<br /> Bicyclomycin targets the transcription termination factor Rho<br /> &lt;ref name='PMID:8466900'/&gt;<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> Genes in ''E. coli'' that affect sensitivity to bicyclomycin.<br /> &lt;ref name='PMID:21357484'/<br /> <br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1362151 Bicyclomycin 2011-10-06T15:16:56Z <p>Denham: </p> <hr /> <div>Bicyclomycin discovered in 1972, has a unique structure that differentiates it from all other antibiotics. Currently used to treat nonspecific diarrhea, it has a low toxicity, and no cross-resistance with other antibiotics has yet been found. It is effective against many Gram-negative bacteria.<br /> &lt;ref name='PMID:16181146'/&gt;<br /> <br /> <br /> ===Mode of Action===<br /> Bicyclomycin inhibits Rho by being a reversible, noncompetitive inhibitor of ATP.<br /> &lt;ref name='PMID:16181146'/&gt;<br /> <br /> ===Structure===<br /> <br /> ===Targets===<br /> Bicyclomycin targets the transcription termination factor Rho<br /> &lt;ref name='PMID:8466900'/&gt;<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> Genes in ''E. coli'' that affect sensitivity to bicyclomycin.<br /> &lt;ref name='PMID:21357484'/<br /> <br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1362150 Bicyclomycin 2011-10-06T15:14:58Z <p>Denham: </p> <hr /> <div>Bicyclomycin discovered in 1972, has a unique structure that differentiates it from all other antibiotics. Currently used to treat nonspecific diarrhea, it has a low toxicity, and no cross-resistance with other antibiotics has yet been found. It is effective against many Gram-negative bacteria.<br /> &lt;ref name='PMID:16181146'/&gt;<br /> <br /> to add a reference: Genes in ''E. coli'' that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> <br /> ===Mode of Action===<br /> Bicyclomycin inhibits Rho by being a reversible, noncompetitive inhibitor of ATP.<br /> <br /> &lt;ref name='PMID:16181146'/&gt;<br /> <br /> ===Structure===<br /> <br /> ===Targets===<br /> Bicyclomycin targets the transcription termination factor Rho<br /> &lt;ref name='PMID:8466900'/&gt;<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> <br /> <br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1362149 Bicyclomycin 2011-10-06T15:14:22Z <p>Denham: </p> <hr /> <div>Bicyclomycin discovered in 1972, has a unique structure that differentiates it from all other antibiotics. Currently used to treat nonspecific diarrhea, it has a low toxicity, and no cross-resistance with other antibiotics has yet been found. It is effective against many Gram-negative bacteria.<br /> &lt;ref name='PMID:16181146'/&gt;<br /> to add a reference: Genes in ''E. coli'' that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> <br /> ===Mode of Action===<br /> Bicyclomycin inhibits Rho by being a reversible, noncompetitive inhibitor of ATP.<br /> <br /> &lt;ref name='PMID:16181146'/&gt;<br /> <br /> ===Structure===<br /> <br /> ===Targets===<br /> Bicyclomycin targets the transcription termination factor Rho<br /> &lt;ref name='PMID:8466900'/&gt;<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> <br /> <br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1362148 Bicyclomycin 2011-10-06T15:13:27Z <p>Denham: </p> <hr /> <div>Bicyclomycin discovered in 1972, has a unique structure that differentiates it from all other antibiotics. Currently used to treat nonspecific diarrhea, it has a low toxicity, and no cross-resistance with other antibiotics has yet been found. It is effective against many Gram-negative bacteria.<br /> <br /> to add a reference: Genes in ''E. coli'' that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> <br /> ===Mode of Action===<br /> Bicyclomycin inhibits Rho by being a reversible, noncompetitive inhibitor of ATP.<br /> <br /> &lt;ref name='PMID:16181146'/&gt;<br /> <br /> ===Structure===<br /> <br /> ===Targets===<br /> Bicyclomycin targets the transcription termination factor Rho<br /> &lt;ref name='PMID:8466900'/&gt;<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> <br /> <br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1362147 Bicyclomycin 2011-10-06T15:12:47Z <p>Denham: </p> <hr /> <div>to add a reference: Genes in ''E. coli'' that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> Bicyclomycin discovered in 1972, has a unique structure that differentiates it from all other antibiotics. Currently used to treat nonspecific diarrhea, it has a low toxicity, and no cross-resistance with other antibiotics has yet been found. It is effective against many Gram-negative bacteria.<br /> <br /> ===Mode of Action===<br /> Bicyclomycin inhibits Rho by being a reversible, noncompetitive inhibitor of ATP.<br /> <br /> &lt;ref name='PMID:16181146'/&gt;<br /> <br /> ===Structure===<br /> <br /> ===Targets===<br /> Bicyclomycin targets the transcription termination factor Rho<br /> &lt;ref name='PMID:8466900'/&gt;<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> <br /> <br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1362146 Bicyclomycin 2011-10-06T15:09:02Z <p>Denham: /* Mode of Action */</p> <hr /> <div>to add a reference: Genes in ''E. coli'' that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> <br /> <br /> ===Mode of Action===<br /> Bicyclomycin inhibits Rho by being a reversible, noncompetitive inhibitor of ATP.<br /> <br /> &lt;ref name='PMID:16181146'/&gt;<br /> <br /> ===Structure===<br /> <br /> ===Targets===<br /> Bicyclomycin targets the transcription termination factor Rho<br /> &lt;ref name='PMID:8466900'/&gt;<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> <br /> <br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1362145 Bicyclomycin 2011-10-06T15:04:08Z <p>Denham: /* Mode of Action */</p> <hr /> <div>to add a reference: Genes in ''E. coli'' that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> <br /> <br /> ===Mode of Action===<br /> <br /> &lt;ref name='PMID:16181146'/&gt;<br /> <br /> ===Structure===<br /> <br /> ===Targets===<br /> Bicyclomycin targets the transcription termination factor Rho<br /> &lt;ref name='PMID:8466900'/&gt;<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> <br /> <br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1362144 Bicyclomycin 2011-10-06T15:03:17Z <p>Denham: /* Mode of Action */</p> <hr /> <div>to add a reference: Genes in ''E. coli'' that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> <br /> <br /> ===Mode of Action===<br /> <br /> &lt;ref name='PMID:16181146'&gt;/<br /> <br /> ===Structure===<br /> <br /> ===Targets===<br /> Bicyclomycin targets the transcription termination factor Rho<br /> &lt;ref name='PMID:8466900'/&gt;<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> <br /> <br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1362143 Bicyclomycin 2011-10-06T15:00:50Z <p>Denham: /* Targets */</p> <hr /> <div>to add a reference: Genes in ''E. coli'' that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> <br /> <br /> ===Mode of Action===<br /> <br /> ===Structure===<br /> <br /> ===Targets===<br /> Bicyclomycin targets the transcription termination factor Rho<br /> &lt;ref name='PMID:8466900'/&gt;<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> <br /> <br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1362142 Bicyclomycin 2011-10-06T14:51:49Z <p>Denham: </p> <hr /> <div>to add a reference: Genes in ''E. coli'' that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> <br /> <br /> ===Mode of Action===<br /> <br /> ===Structure===<br /> <br /> ===Targets===<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> <br /> <br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1358866 Bicyclomycin 2011-09-29T16:02:20Z <p>Denham: </p> <hr /> <div>to add a reference: Genes in ''E. coli'' that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> <br /> how it works<br /> <br /> related drugs<br /> <br /> target genes or pathways<br /> <br /> ===Mode of Action===<br /> <br /> ===Targets===<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> <br /> <br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1358865 Bicyclomycin 2011-09-29T15:57:26Z <p>Denham: </p> <hr /> <div>to add a reference: Genes in E. coli that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> <br /> ===Mode of Action===<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> &lt;protect&gt;&lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;R4e84956686066&quot; class=&quot; tableEdit &quot; <br /> |-<br /> !|Gene!!Allele!!Sensitivity to BCM!!Reference<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066&amp;page=180696&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template= edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=63ce1649aab8b3180235b0af7618f667.180696.R4e84956686066--&gt;&lt;/protect&gt;<br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1358864 Bicyclomycin 2011-09-29T15:53:40Z <p>Denham: </p> <hr /> <div>to add a reference: Genes in E. coli that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> <br /> ===Mode of Action===<br /> <br /> ===Mechanisms of Resistance===<br /> <br /> ===Mutations that affect sensitivity===<br /> <br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1358863 Bicyclomycin 2011-09-29T15:50:29Z <p>Denham: </p> <hr /> <div>to add a reference: Genes in E. coli that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;<br /> <br /> <br /> <br /> <br /> <br /> <br /> ==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;<br /> <br /> __NOTOC__</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1358862 Bicyclomycin 2011-09-29T15:50:06Z <p>Denham: </p> <hr /> <div>==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;<br /> <br /> __NOTOC__<br /> <br /> <br /> to add a reference: Genes in E. coli that affect sensitivity to bicyclomycin.&lt;ref name='PMID:21357484'/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1358861 Bicyclomycin 2011-09-29T15:48:41Z <p>Denham: </p> <hr /> <div>==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;<br /> <br /> __NOTOC__<br /> <br /> <br /> to add a reference: Rho factor is the target for bicyclomycin in E. coli.&lt;ref name='PMID:xxxx'/&gt;</div> Denham https://ecoliwiki.org/colipedia/index.php?title=Bicyclomycin&diff=1358860 Bicyclomycin 2011-09-29T15:46:19Z <p>Denham: New Template:Empty_Page Page</p> <hr /> <div>==References==<br /> {{RefHelp}}<br /> &lt;references/&gt;<br /> <br /> __NOTOC__</div> Denham https://ecoliwiki.org/colipedia/index.php?title=yebV:Gene&diff=1358859 yebV:Gene 2011-09-29T14:02:18Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|yebV}}{{Tab On|Gene|yebV}}{{Tab|Gene Product(s)|yebV}}{{Tab|Expression|yebV}}{{Tab|Evolution|yebV}}{{Tab|On One Page|yebV}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14245.A46a9d00db7e0e--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;A46a9d00db7e0e&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''yebV''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Systematic nomenclature<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK1835, b1836, JW5302''&lt;ref name='LIB:Riley_2006'/&gt;, JW5302''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14245.A46a9d00db7e0e&amp;page=14245&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14245.A46a9d00db7e0e--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14245.T46a9d00e3fc1d--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;T46a9d00e3fc1d&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 41.38 minutes, 41.38 minutes&amp;nbsp;<br /> |<br /> MG1655: 1919804..1920040&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:1919804..1920040<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=G7009 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|1918804|1921040|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|1919804|1920040|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=G7009 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 1900357..1900593&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:1900357..1900593<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|1900357|1900593|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|1900357|1900593|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 1811863..1812099&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:1811863..1812099<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|1811863|1812099|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|1811863|1812099|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 1923494..1923730&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:1923494..1923730<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|1922494|1924730|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|1923494|1923730|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 2010375..2010611&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:2010375..2010611<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|2009903|2011083|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|2009903|2011083|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14245.T46a9d00e3fc1d&amp;page=14245&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14245.T46a9d00e3fc1d--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14245.Z46a9d00ee7a63--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;Z46a9d00ee7a63&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14245.Z46a9d00ee7a63&amp;page=14245&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14245.Z46a9d00ee7a63--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14245.X46a9d00f37649--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;X46a9d00f37649&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;yebV (Keio:JW5302)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=109589 CGSC11308]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;yebV761::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:104430|CGSC:104430]]<br /> |<br /> <br /> |- <br /> |<br /> yebV<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases sensitivity to bicyclomycin<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14245.X46a9d00f37649&amp;page=14245&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14245.X46a9d00f37649--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.14245.P4e04c84e923b1--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;P4e04c84e923b1&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.14245.P4e04c84e923b1&amp;page=14245&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.14245.P4e04c84e923b1--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14245.R46a9d00fde536--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;R46a9d00fde536&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW5302<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCAAAACCAGTGTGCGCATAGG<br /> <br /> Primer 2:CCGGCAAGACGCATAATCCAGGC <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:19H3|19H3]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=336 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[yeaI:Gene|zea-225::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18465 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39973 CGSC7388]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 10% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zdj-225::Tn10 <br /> |- <br /> |<br /> [[eda:Gene|eda-51::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18486 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39983 CGSC7392]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 70% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14245.R46a9d00fde536&amp;page=14245&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14245.R46a9d00fde536--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14245.C46a9d0107b0a0--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;C46a9d0107b0a0&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=G7009 ECOCYC:G7009]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG14024 EcoGene:EG14024]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=946347 GeneID:946347]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14245.C46a9d0107b0a0&amp;page=14245&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14245.C46a9d0107b0a0--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14245.F46a6ed6b1454e--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;F46a6ed6b1454e&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14245.F46a6ed6b1454e&amp;page=14245&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14245.F46a6ed6b1454e--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:yeb genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:y genes]]<br /> [[Category:y genes]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=ydjO:Gene&diff=1358858 ydjO:Gene 2011-09-29T14:01:16Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|ydjO}}{{Tab On|Gene|ydjO}}{{Tab|Gene Product(s)|ydjO}}{{Tab|Expression|ydjO}}{{Tab|Evolution|ydjO}}{{Tab|On One Page|ydjO}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14031.T46a9cd97e50b6--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;T46a9cd97e50b6&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''ydjO''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Systematic nomenclature<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK1728, b1730, JW1719''&lt;ref name='LIB:Riley_2006'/&gt;, JW1719''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14031.T46a9cd97e50b6&amp;page=14031&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14031.T46a9cd97e50b6--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14031.D46a9cd986ca95--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;D46a9cd986ca95&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 39.02 minutes, 39.02 minutes&amp;nbsp;<br /> |<br /> MG1655: 1811168..1810353&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:1810353..1811168<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=G6935 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|1809353|1812168|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|1810353|1811168|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=G6935 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 1790409..1789615&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:1789615..1790409<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|1789615|1790409|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|1789615|1790409|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 1702412..1703227&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:1702412..1703227<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|1702412|1703227|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|1702412|1703227|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 1814858..1814043&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:1814043..1814858<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|1813043|1815858|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|1814043|1814858|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 1901739..1900924&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:1900924..1901739<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|1899294|1903369|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|1899294|1903369|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14031.D46a9cd986ca95&amp;page=14031&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14031.D46a9cd986ca95--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14031.J46a9cd991e5f3--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;J46a9cd991e5f3&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14031.J46a9cd991e5f3&amp;page=14031&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14031.J46a9cd991e5f3--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14031.Z46a9cd9961971--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;Z46a9cd9961971&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;ydjO (Keio:JW1719)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=107732 CGSC9451]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;ydjO729::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:104364|CGSC:104364]]<br /> |<br /> <br /> |- <br /> |<br /> ydjO<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> decreases sensitivity to bicyclomycin<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> mutation didn't affect sensitivity of any of 22 other antibiotics tested.<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14031.Z46a9cd9961971&amp;page=14031&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14031.Z46a9cd9961971--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.14031.V4e04c81f78f5e--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;V4e04c81f78f5e&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.14031.V4e04c81f78f5e&amp;page=14031&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.14031.V4e04c81f78f5e--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14031.Z46a9cd9a13791--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;Z46a9cd9a13791&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW1719<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCAGGCGGGAGATGTTTTCTAC<br /> <br /> Primer 2:CCTGCTGGCAACGGTCCGTTTTG <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:8A4|8A4]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=324 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:19B6|19B6]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=325 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> zdi-925::Tn10<br /> |<br /> Linked marker<br /> |<br /> CAG12151 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39862 CGSC7385]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 26% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zdh-925::Tn10 <br /> |- <br /> |<br /> [[ynjB:Gene|zdj-276::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18464 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39972 CGSC7387]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 44% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zdi-276::Tn10 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14031.Z46a9cd9a13791&amp;page=14031&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14031.Z46a9cd9a13791--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14031.A46a9cd9aa3a12--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;A46a9cd9aa3a12&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=G6935 ECOCYC:G6935]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG13991 EcoGene:EG13991]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=946237 GeneID:946237]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14031.A46a9cd9aa3a12&amp;page=14031&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14031.A46a9cd9aa3a12--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14031.V46a6eafbf0bc2--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;V46a6eafbf0bc2&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.14031.V46a6eafbf0bc2&amp;page=14031&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.14031.V46a6eafbf0bc2--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:ydj genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:y genes]]<br /> [[Category:y genes]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=ydhT:Gene&diff=1358857 ydhT:Gene 2011-09-29T13:59:57Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|ydhT}}{{Tab On|Gene|ydhT}}{{Tab|Gene Product(s)|ydhT}}{{Tab|Expression|ydhT}}{{Tab|Evolution|ydhT}}{{Tab|On One Page|ydhT}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13905.D46a9cc26a56d8--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;D46a9cc26a56d8&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''ydhT''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Systematic nomenclature<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK1665, b1669, JW1659''&lt;ref name='LIB:Riley_2006'/&gt;, JW1659''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13905.D46a9cc26a56d8&amp;page=13905&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13905.D46a9cc26a56d8--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13905.U46a9cc272c6b5--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;U46a9cc272c6b5&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 37.65 minutes&amp;nbsp;<br /> |<br /> MG1655: 1747583..1746771&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:1746771..1747583<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=G6897 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|1745771|1748583|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|1746771|1747583|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=G6897 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 1726826..1726014&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:1726014..1726826<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|1726014|1726826|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|1726014|1726826|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 1638830..1639642&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:1638830..1639642<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|1638830|1639642|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|1638830|1639642|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 1751273..1750461&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:1750461..1751273<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|1749461|1752273|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|1750461|1751273|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 1838154..1837342&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:1837342..1838154<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|1835718|1839778|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|1835718|1839778|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13905.U46a9cc272c6b5&amp;page=13905&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13905.U46a9cc272c6b5--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13905.B46a9cc27d1ed2--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;B46a9cc27d1ed2&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13905.B46a9cc27d1ed2&amp;page=13905&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13905.B46a9cc27d1ed2--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13905.J46a9cc2820d5e--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;J46a9cc2820d5e&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;ydhT (Keio:JW1659)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=107693 CGSC9412]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;ydhT744::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:104302|CGSC:104302]]<br /> |<br /> <br /> |- <br /> |<br /> ydhT<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases sensitivity to bicyclomycin<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13905.J46a9cc2820d5e&amp;page=13905&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13905.J46a9cc2820d5e--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.13905.X4e04c7f32f7f1--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;X4e04c7f32f7f1&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.13905.X4e04c7f32f7f1&amp;page=13905&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.13905.X4e04c7f32f7f1--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13905.D46a9cc28c6423--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;D46a9cc28c6423&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW1659<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCATCATTACACAAGCAGACCT<br /> <br /> Primer 2:CCGCACTCAACAAACTGATGCTG <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:13H4|13H4]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=319 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[yddE:Gene|zdd-235::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18461 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39848 CGSC7378]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: % &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zdc-235::Tn10 <br /> |- <br /> |<br /> zdi-925::Tn10<br /> |<br /> Linked marker<br /> |<br /> CAG12151 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39862 CGSC7385]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 31% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zdh-925::Tn10 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13905.D46a9cc28c6423&amp;page=13905&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13905.D46a9cc28c6423--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13905.S46a9cc2961e9c--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;S46a9cc2961e9c&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=G6897 ECOCYC:G6897]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG13954 EcoGene:EG13954]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=945960 GeneID:945960]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13905.S46a9cc2961e9c&amp;page=13905&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13905.S46a9cc2961e9c--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13905.O46a6e98f1cf77--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;O46a6e98f1cf77&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13905.O46a6e98f1cf77&amp;page=13905&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13905.O46a6e98f1cf77--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:ydh genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:y genes]]<br /> [[Category:y genes]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=yciM:Gene&diff=1358856 yciM:Gene 2011-09-29T13:58:52Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|yciM}}{{Tab On|Gene|yciM}}{{Tab|Gene Product(s)|yciM}}{{Tab|Expression|yciM}}{{Tab|Evolution|yciM}}{{Tab|On One Page|yciM}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13127.S46a9c3b2f3291--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;S46a9c3b2f3291&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''yciM''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Systematic nomenclature<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK1275, b1280, JW1272''&lt;ref name='LIB:Riley_2006'/&gt;, JW1272''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13127.S46a9c3b2f3291&amp;page=13127&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13127.S46a9c3b2f3291--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13127.C46a9c3b378936--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;C46a9c3b378936&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 28.85 minutes&amp;nbsp;<br /> |<br /> MG1655: 1338582..1339751&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:1338582..1339751<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG12691 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|1337582|1340751|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|1338582|1339751|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG12691 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 1338930..1340099&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:1338930..1340099<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|1338930|1340099|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|1338930|1340099|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 1229431..1230600&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:1229431..1230600<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|1229431|1230600|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|1229431|1230600|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 1342272..1343441&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:1342272..1343441<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|1341272|1344441|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|1342272|1343441|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 1427978..1429147&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:1427978..1429147<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|1425640|1431485|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|1425640|1431485|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13127.C46a9c3b378936&amp;page=13127&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13127.C46a9c3b378936--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13127.K46a9c3b42600b--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;K46a9c3b42600b&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13127.K46a9c3b42600b&amp;page=13127&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13127.K46a9c3b42600b--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13127.L46a9c3b4678b1--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;L46a9c3b4678b1&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;yciM (Keio:JW1272)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=107425 CGSC9144]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;yciM::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|DL-a-Glycerol]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;yciM::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|Acetate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;yciM::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|a-Ketobutyrate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;yciM::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|a-Ketoglutarate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;yciM::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|Succinate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;yciM::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|Bromosuccinate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;yciM::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|L-Alanine]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;yciM::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|L-Alanyl-glycine]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;yciM::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|L-Asparagine]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;yciM::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|L-Aspartate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;yciM::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|L-Serine]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;yciM788::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:104066|CGSC:104066]]<br /> |<br /> <br /> |- <br /> |<br /> yciM<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases sensitivity to bicyclomycin<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13127.L46a9c3b4678b1&amp;page=13127&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13127.L46a9c3b4678b1--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.13127.G4e04c7558e29a--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;G4e04c7558e29a&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.13127.G4e04c7558e29a&amp;page=13127&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.13127.G4e04c7558e29a--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13127.J46a9c3b514e8b--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;J46a9c3b514e8b&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW1272<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCCTGGAGTTGTTGTTTCTGCT<br /> <br /> Primer 2:CCaAGGCCATCAAGACCGCGAAT <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:18B6|18B6]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=255 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[trpC:Gene|trpC83::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18455 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39837 CGSC7371]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 46% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:trpB83::Tn10 <br /> |- <br /> |<br /> [[ycjM:Gene|zcj-233::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12028 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39843 CGSC7373]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 31% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zci-233::Tn10 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13127.J46a9c3b514e8b&amp;page=13127&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13127.J46a9c3b514e8b--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13127.F46a9c3b5a1907--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;F46a9c3b5a1907&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG12691 ECOCYC:EG12691]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG12691 EcoGene:EG12691]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=944858 GeneID:944858]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13127.F46a9c3b5a1907&amp;page=13127&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13127.F46a9c3b5a1907--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13127.C46a6e12ed571a--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;C46a6e12ed571a&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13127.C46a6e12ed571a&amp;page=13127&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13127.C46a6e12ed571a--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:yci genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:y genes]]<br /> [[Category:y genes]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=ybaB:Gene&diff=1358855 ybaB:Gene 2011-09-29T13:57:40Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|ybaB}}{{Tab On|Gene|ybaB}}{{Tab|Gene Product(s)|ybaB}}{{Tab|Expression|ybaB}}{{Tab|Evolution|ybaB}}{{Tab|On One Page|ybaB}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.11507.H46a9b17dbb56b--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;H46a9b17dbb56b&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''ybaB''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Systematic nomenclature<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK0465, b0471, JW0460, dnaZ''&lt;ref name='LIB:Riley_2006'/&gt;&lt;ref name='LIB:EcoCyc11.1'/&gt;<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.11507.H46a9b17dbb56b&amp;page=11507&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.11507.H46a9b17dbb56b--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.11507.O46a9b17e6d02f--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;O46a9b17e6d02f&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 10.63 minutes&amp;nbsp;<br /> |<br /> MG1655: 493300..493629&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:493300..493629<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG11100 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|492300|494629|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|493300|493629|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG11100 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 466143..466472&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:466143..466472<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|466143|466472|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|466143|466472|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 396059..396388&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:396059..396388<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|396059|396388|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|396059|396388|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 493300..493629&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:493300..493629<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|492300|494629|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|493300|493629|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 432631..432960&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:432631..432960<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|431973|433618|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|431973|433618|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.11507.O46a9b17e6d02f&amp;page=11507&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.11507.O46a9b17e6d02f--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.11507.G46a9b17f5b0df--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;G46a9b17f5b0df&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.11507.G46a9b17f5b0df&amp;page=11507&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.11507.G46a9b17f5b0df--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.11507.X46a9b17fc83ce--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;X46a9b17fc83ce&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;ybaB (Keio:JW0460)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=106895 CGSC8614]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;ybaB755::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:103626|CGSC:103626]]<br /> |<br /> <br /> |- <br /> |<br /> ybaB<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases sensitivity to bicyclomycin<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.11507.X46a9b17fc83ce&amp;page=11507&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.11507.X46a9b17fc83ce--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.11507.J4e04c63c26cc6--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;J4e04c63c26cc6&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.11507.J4e04c63c26cc6&amp;page=11507&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.11507.J4e04c63c26cc6--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.11507.M46a9b180c28fa--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;M46a9b180c28fa&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW0460<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCTTTGGTAAAGGCGGTCTGGG<br /> <br /> Primer 2:CCGAACGGCATCTTAAAGCCAGG <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:12H5|12H5]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=152 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[ppiD:Gene|zaj-3054::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12017 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39373 CGSC7339]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 25% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zba-3054::Tn10 <br /> |- <br /> |<br /> [[gsk:Gene|gsk-3055::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12154 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39379 CGSC7341]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 77% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zbb-30-55::TnlO, zba-3055::Tn10 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.11507.M46a9b180c28fa&amp;page=11507&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.11507.M46a9b180c28fa--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.11507.U46a9b181a9d5f--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;U46a9b181a9d5f&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG11100 ECOCYC:EG11100]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG11100 EcoGene:EG11100]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=945104 GeneID:945104]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.11507.U46a9b181a9d5f&amp;page=11507&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.11507.U46a9b181a9d5f--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.11507.G46a6cf0e8078d--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;G46a6cf0e8078d&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.11507.G46a6cf0e8078d&amp;page=11507&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.11507.G46a6cf0e8078d--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:yba genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:y genes]]<br /> [[Category:y genes]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=ydfA:Gene&diff=1358854 ydfA:Gene 2011-09-29T13:56:18Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|ydfA}}{{Tab On|Gene|ydfA}}{{Tab|Gene Product(s)|ydfA}}{{Tab|Expression|ydfA}}{{Tab|Evolution|ydfA}}{{Tab|On One Page|ydfA}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13707.N46a9c9e647e87--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;N46a9c9e647e87&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''ydfA''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Systematic nomenclature<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK1565, b1571, JW1563''&lt;ref name='LIB:Riley_2006'/&gt;<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13707.N46a9c9e647e87&amp;page=13707&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13707.N46a9c9e647e87--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13707.U46a9c9e6c2a6e--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;U46a9c9e6c2a6e&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 35.49 minutes&amp;nbsp;<br /> |<br /> MG1655: 1646532..1646687&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:1646532..1646687<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG11300 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|1645532|1647687|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|1646532|1646687|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG11300 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 1538591..1538746&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:1538591..1538746<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|1538591|1538746|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|1538591|1538746|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 1650222..1650377&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:1650222..1650377<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|1649222|1651377|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|1650222|1650377|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 1736157..1736312&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:1736157..1736312<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|1735847|1736622|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|1735847|1736622|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13707.U46a9c9e6c2a6e&amp;page=13707&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13707.U46a9c9e6c2a6e--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13707.Y46a9c9e772eb9--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;Y46a9c9e772eb9&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13707.Y46a9c9e772eb9&amp;page=13707&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13707.Y46a9c9e772eb9--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13707.A46a9c9e7b578c--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;A46a9c9e7b578c&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;ydfA (Keio:JW1563)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=107618 CGSC9337]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;ydfA::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|a-Ketoglutarate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;ydfA::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|L-Aspartate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;ydfA721::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:104238|CGSC:104238]]<br /> |<br /> <br /> |- <br /> |<br /> ydfA<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases sensitivity to bicyclomycin<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13707.A46a9c9e7b578c&amp;page=13707&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13707.A46a9c9e7b578c--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.13707.G4e04c7c2e2cca--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;G4e04c7c2e2cca&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.13707.G4e04c7c2e2cca&amp;page=13707&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.13707.G4e04c7c2e2cca--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13707.T46a9c9e865d79--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;T46a9c9e865d79&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW1563<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCGATACTATCGATCTTGGCAA<br /> <br /> Primer 2:CCtTCACCTGAGTTTCTTTCCAG <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:12E2|12E2]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=308 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:7B6|7B6]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=309 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[yddE:Gene|zdd-235::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18461 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39848 CGSC7378]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: % &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zdc-235::Tn10 <br /> |- <br /> |<br /> zdi-925::Tn10<br /> |<br /> Linked marker<br /> |<br /> CAG12151 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39862 CGSC7385]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: % &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zdh-925::Tn10 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13707.T46a9c9e865d79&amp;page=13707&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13707.T46a9c9e865d79--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13707.Z46a9c9e900d01--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;Z46a9c9e900d01&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13707.Z46a9c9e900d01&amp;page=13707&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13707.Z46a9c9e900d01--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13707.H46a6e7526821b--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;H46a6e7526821b&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13707.H46a6e7526821b&amp;page=13707&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13707.H46a6e7526821b--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:Gene List:Qin prophage]]<br /> [[Category:ydf genes]][[Category:Gene_List:DH10B]]<br /> [[Category:y genes]]<br /> [[Category:y genes]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=yciT:Gene&diff=1358853 yciT:Gene 2011-09-29T13:54:28Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|yciT}}{{Tab On|Gene|yciT}}{{Tab|Gene Product(s)|yciT}}{{Tab|Expression|yciT}}{{Tab|Evolution|yciT}}{{Tab|On One Page|yciT}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13135.G46a9c3cacb5e6--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;G46a9c3cacb5e6&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''yciT''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Systematic nomenclature<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''yciT, ECK1279, b1284, JW1276'', deoT&lt;ref name='LIB:Riley_2006'/&gt;&lt;ref name='LIB:EcoCyc10.6'/&gt;, deoT, JW1276''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13135.G46a9c3cacb5e6&amp;page=13135&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13135.G46a9c3cacb5e6--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13135.C46a9c3cb5716d--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;C46a9c3cb5716d&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 28.92 minutes&amp;nbsp;<br /> |<br /> MG1655: 1342370..1341621&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:1341621..1342370<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=G6638 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|1340621|1343370|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|1341621|1342370|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=G6638 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 1342717..1341968&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:1341968..1342717<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|1341968|1342717|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|1341968|1342717|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 1232470..1233219&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:1232470..1233219<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|1232470|1233219|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|1232470|1233219|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 1346060..1345311&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:1345311..1346060<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|1344311|1347060|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|1345311|1346060|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 1431766..1431017&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:1431017..1431766<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|1429519|1433264|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|1429519|1433264|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13135.C46a9c3cb5716d&amp;page=13135&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13135.C46a9c3cb5716d--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13135.X46a9c3cc053e7--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;X46a9c3cc053e7&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13135.X46a9c3cc053e7&amp;page=13135&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13135.X46a9c3cc053e7--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13135.P46a9c3cc47092--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;P46a9c3cc47092&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> ''&amp;#916;yciT721::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:104076|CGSC:104076]]<br /> |<br /> <br /> |- <br /> |<br /> yciT<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases sensitivity to bicyclomycin<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13135.P46a9c3cc47092&amp;page=13135&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13135.P46a9c3cc47092--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.13135.N4e04c75b79f1e--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;N4e04c75b79f1e&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.13135.N4e04c75b79f1e&amp;page=13135&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.13135.N4e04c75b79f1e--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13135.D46a9c3cce8fde--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;D46a9c3cce8fde&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> <br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:<br /> <br /> Primer 1:<br /> <br /> Primer 2: <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:18B6|18B6]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=255 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:E14F6|E14F6]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=256 Genobase]<br /> |<br /> PMID:3038334 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13135.D46a9c3cce8fde&amp;page=13135&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13135.D46a9c3cce8fde--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13135.U46a9c3cd817b3--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;U46a9c3cd817b3&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=G6638 ECOCYC:G6638]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG13905 EcoGene:EG13905]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=945869 GeneID:945869]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13135.U46a9c3cd817b3&amp;page=13135&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13135.U46a9c3cd817b3--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13135.C46a6e1472a9c1--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;C46a6e1472a9c1&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13135.C46a6e1472a9c1&amp;page=13135&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13135.C46a6e1472a9c1--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes not in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:deo genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:yci genes]]<br /> [[Category:y genes]]<br /> [[Category:y genes]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=hns:Gene&diff=1358852 hns:Gene 2011-09-29T13:53:26Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|hns}}{{Tab On|Gene|hns}}{{Tab|Gene Product(s)|hns}}{{Tab|Expression|hns}}{{Tab|Evolution|hns}}{{Tab|On One Page|hns}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13041.X46a9c2b14983c--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;X46a9c2b14983c&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''hns''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Histone-like protein H-NS<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK1232, b1237, JW1225, bglY, cur, drc, drdX, drs, irk, mssyA, msyA, osmZ, pilG, topX, virR, hnsA, topS, B1, H1''&lt;ref name='LIB:Riley_2006'/&gt;, fimG, H1, verA''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13041.X46a9c2b14983c&amp;page=13041&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13041.X46a9c2b14983c--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13041.L46a9c2b1c59e1--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;L46a9c2b1c59e1&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 27.84 minutes&amp;nbsp;<br /> |<br /> MG1655: 1292145..1291732&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:1291732..1292145<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG10457 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|1290732|1293145|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|1291732|1292145|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG10457 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 1292716..1292303&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:1292303..1292716<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|1292303|1292716|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|1292303|1292716|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 1181230..1181643&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:1181230..1181643<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|1181230|1181643|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|1181230|1181643|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 1294499..1294086&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:1294086..1294499<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|1293086|1295499|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|1294086|1294499|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 1332386..1331973&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:1331973..1332386<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|1331147|1333212|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|1331147|1333212|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13041.L46a9c2b1c59e1&amp;page=13041&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13041.L46a9c2b1c59e1--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13041.X46a9c2b2729c5--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;X46a9c2b2729c5&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> |- <br /> |<br /> Coding Start (SO:0000323)<br /> |<br /> [[MG1655]]<br /> |<br /> 1291735<br /> |<br /> Edman degradation<br /> |<br /> PMID:2020545&lt;br /&gt;PMID:2126011&lt;br /&gt;PMID:6370250&lt;br /&gt;PMID:8740179&lt;br /&gt;PMID:9298646&lt;br /&gt;PMID:9600841&lt;br /&gt;PMID:9740056&lt;br /&gt;<br /> |<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13041.X46a9c2b2729c5&amp;page=13041&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13041.X46a9c2b2729c5--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13041.P46a9c2b2b4118--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;P46a9c2b2b4118&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;hns (Keio:JW1225)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=107392 CGSC9111]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0004152 hns::Tn5KAN-2] (FB20271)<br /> |<br /> Insertion at nt 323 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB20271]<br /> |<br /> does not contain [[pKD46]] <br /> |- <br /> |<br /> &amp;Delta;hns::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|D-Galactoniate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;hns::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|D-Galacturonate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;hns::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|D-Glucuronate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;hns::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|Acetate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;hns::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|a-Hydroxybutyrate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;hns::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|a-Ketobutyrate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;hns::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|a-Ketoglutarate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;hns::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|Succinate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;hns::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|Bromosuccinate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;hns::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|L-Alanine]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;hns::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|L-Asparagine]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;hns::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|L-Aspartate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> ''hns-206''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:19435|CGSC:19435]]<br /> |<br /> <br /> |- <br /> |<br /> ''hns-1''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:26967|CGSC:26967]]<br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;hns-746::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:101388|CGSC:101388]]<br /> |<br /> <br /> |- <br /> |<br /> hns<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases sensitivity to bicyclomycin<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13041.P46a9c2b2b4118&amp;page=13041&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13041.P46a9c2b2b4118--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.13041.P4e04bd182e8da--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;P4e04bd182e8da&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.13041.P4e04bd182e8da&amp;page=13041&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.13041.P4e04bd182e8da--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13041.L46a9c2b361571--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;L46a9c2b361571&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW1225<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCAGCGAAGCACTTAAAATTCT<br /> <br /> Primer 2:CCTTGCTTGATCAGGAAATCGTC <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:4D8|4D8]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=250 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:3D5|3D5]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=251 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[fadR:Gene|fadR13::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18497 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39426 CGSC7365]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 5% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> |- <br /> |<br /> [[oppC:Gene|oppC506::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12169 = [http://cgsc2.biology.yale.edu/Strain.php?ID=38027 CGSC7369]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 66% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zch-506::Tn10, zci-506::Tn10 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13041.L46a9c2b361571&amp;page=13041&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13041.L46a9c2b361571--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13041.N46a9c2b3edb75--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;N46a9c2b3edb75&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG10457 ECOCYC:EG10457]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG10457 EcoGene:EG10457]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=945829 GeneID:945829]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13041.N46a9c2b3edb75&amp;page=13041&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13041.N46a9c2b3edb75--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13041.O46a6e029c1ee5--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;O46a6e029c1ee5&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.13041.O46a6e029c1ee5&amp;page=13041&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.13041.O46a6e029c1ee5--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:hns genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=iscS:Gene&diff=1358851 iscS:Gene 2011-09-29T13:50:34Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|iscS}}{{Tab On|Gene|iscS}}{{Tab|Gene Product(s)|iscS}}{{Tab|Expression|iscS}}{{Tab|Evolution|iscS}}{{Tab|On One Page|iscS}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15629.G46a9e0370cb5a--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;G46a9e0370cb5a&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''iscS''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Iron-sulfur cluster<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK2527, b2530, JW2514, csdB, yfhO, nifS, yzzO, nuvC?''&lt;ref name='LIB:Riley_2006'/&gt;&lt;ref name='LIB:EcoCyc10.6'/&gt;, nuvC''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15629.G46a9e0370cb5a&amp;page=15629&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15629.G46a9e0370cb5a--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15629.C46a9e0378b728--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;C46a9e0378b728&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 57.3 minutes&amp;nbsp;<br /> |<br /> MG1655: 2659553..2658339&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:2658339..2659553<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=G7325 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|2657339|2660553|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|2658339|2659553|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=G7325 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 2582230..2581016&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:2581016..2582230<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|2581016|2582230|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|2581016|2582230|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 2544144..2545358&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:2544144..2545358<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|2544144|2545358|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|2544144|2545358|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 2660187..2658973&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:2658973..2660187<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|2657973|2661187|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|2658973|2660187|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 2751318..2750104&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:2750104..2751318<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|2747676|2753746|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|2747676|2753746|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15629.C46a9e0378b728&amp;page=15629&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15629.C46a9e0378b728--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15629.V46a9e038447fd--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;V46a9e038447fd&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> |- <br /> |<br /> Coding Start (SO:0000323)<br /> |<br /> [[MG1655]]<br /> |<br /> 2658339<br /> |<br /> Edman degradation<br /> |<br /> PMID:9298646&lt;br /&gt;<br /> |<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15629.V46a9e038447fd&amp;page=15629&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15629.V46a9e038447fd--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15629.Q46a9e0388a635--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;Q46a9e0388a635&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;iscS (Keio:JW2514)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=108283 CGSC10002]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> iscSC328A<br /> |<br /> <br /> |<br /> C328A<br /> |<br /> <br /> |<br /> Loss of cysteine desulfurization<br /> |<br /> <br /> |<br /> <br /> |<br /> seeded from [http://www.uniprot.org/uniprot/P0A6B7 UniProt:P0A6B7] <br /> |- <br /> |<br /> ''&amp;#916;iscS776::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:101588|CGSC:101588]]<br /> |<br /> <br /> |- <br /> |<br /> iscS<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases sensitivity to bicyclomycin<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15629.Q46a9e0388a635&amp;page=15629&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15629.Q46a9e0388a635--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.15629.F4e04bdfaa9e91--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;F4e04bdfaa9e91&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.15629.F4e04bdfaa9e91&amp;page=15629&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.15629.F4e04bdfaa9e91--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15629.C46a9e03943284--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;C46a9e03943284&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW2514<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCAAATTACCGATTTATCTCGA<br /> <br /> Primer 2:CCATGATGAGCCCATTCGATGCT <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:5E10|5E10]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=430 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[purC:Gene|purC80::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18470 = [http://cgsc2.biology.yale.edu/Strain.php?ID=38904 CGSC7413]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 3% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> |- <br /> |<br /> [[hcaT:Gene|zfh-208::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18481 = [http://cgsc2.biology.yale.edu/Strain.php?ID=40086 CGSC7417]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 85% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; &lt;br /&gt; <br /> Synonyms:zff-208::Tn10 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15629.C46a9e03943284&amp;page=15629&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15629.C46a9e03943284--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15629.P46a9e039d984c--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;P46a9e039d984c&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=G7325 ECOCYC:G7325]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG12677 EcoGene:EG12677]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=947004 GeneID:947004]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15629.P46a9e039d984c&amp;page=15629&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15629.P46a9e039d984c--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15629.E46a6fd029ff1a--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;E46a6fd029ff1a&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.15629.E46a6fd029ff1a&amp;page=15629&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.15629.E46a6fd029ff1a--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:isc genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=gpmM:Gene&diff=1358850 gpmM:Gene 2011-09-29T13:49:19Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|gpmM}}{{Tab On|Gene|gpmM}}{{Tab|Gene Product(s)|gpmM}}{{Tab|Expression|gpmM}}{{Tab|Evolution|gpmM}}{{Tab|On One Page|gpmM}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17779.E46a9fa5d511d6--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;E46a9fa5d511d6&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''gpmM''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Glycerol P mutase, Mn-dependent<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''gpmI, ECK3602, b3612, JW3587, yibO, pmgI, gpmC, pgmI''&lt;ref name='LIB:Riley_2006'/&gt;&lt;ref name='LIB:EcoCyc11.1'/&gt;, pgmI''<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17779.E46a9fa5d511d6&amp;page=17779&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17779.E46a9fa5d511d6--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17779.E46a9fa5dd3602--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;E46a9fa5dd3602&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 81.54 minutes&amp;nbsp;<br /> |<br /> MG1655: 3783283..3784827&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:3783283..3784827<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG12296 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|3782283|3785827|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|3783283|3784827|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG12296 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 3726026..3727570&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:3726026..3727570<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|3726026|3727570|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|3726026|3727570|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 3671609..3673153&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:3671609..3673153<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|3671609|3673153|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|3671609|3673153|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 3855155..3853611&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:3853611..3855155<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|3852611|3856155|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|3853611|3855155|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17779.E46a9fa5dd3602&amp;page=17779&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17779.E46a9fa5dd3602--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17779.Q46a9fa5e96441--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;Q46a9fa5e96441&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17779.Q46a9fa5e96441&amp;page=17779&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17779.Q46a9fa5e96441--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17779.K46a9fa5edfd39--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;K46a9fa5edfd39&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0011818 yibO::Tn5KAN-2] (FB21341)<br /> |<br /> Insertion at nt 1343 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB21341]<br /> |<br /> contains [[pKD46]] <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0011818 yibO::Tn5KAN-2] (FB21342)<br /> |<br /> Insertion at nt 1343 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB21342]<br /> |<br /> does not contain [[pKD46]] <br /> |- <br /> |<br /> &amp;Delta;yibO::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|Acetate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;yibO::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|a-Ketobutyrate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;yibO::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|a-Ketoglutarate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;yibO::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|Succinate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;yibO::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|Bromosuccinate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> &amp;Delta;yibO::kan<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> [[Biolog]]:respiration<br /> |<br /> unable to respire [[Carbon sources|L-Aspartate]]<br /> |<br /> PMID:16095938<br /> |<br /> <br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;gpmM724::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:106202|CGSC:106202]]<br /> |<br /> <br /> |- <br /> |<br /> gpmM<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases sensitivity to bicyclomycin<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17779.K46a9fa5edfd39&amp;page=17779&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17779.K46a9fa5edfd39--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.17779.L4e04bc8953fed--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;L4e04bc8953fed&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.17779.L4e04bc8953fed&amp;page=17779&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.17779.L4e04bc8953fed--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17779.J46a9fa5fa2f0b--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;J46a9fa5fa2f0b&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> <br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:<br /> <br /> Primer 1:<br /> <br /> Primer 2: <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:5D2|5D2]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=575 Genobase]<br /> |<br /> PMID:3038334 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17779.J46a9fa5fa2f0b&amp;page=17779&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17779.J46a9fa5fa2f0b--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17779.Z46a9fa604d258--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;Z46a9fa604d258&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG12296 ECOCYC:EG12296]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG12296 EcoGene:EG12296]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=948130 GeneID:948130]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17779.Z46a9fa604d258&amp;page=17779&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17779.Z46a9fa604d258--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17779.X46a714d5bc690--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;X46a714d5bc690&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.17779.X46a714d5bc690&amp;page=17779&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.17779.X46a714d5bc690--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes not in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:gpm genes]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham https://ecoliwiki.org/colipedia/index.php?title=fabF:Gene&diff=1358849 fabF:Gene 2011-09-29T13:47:37Z <p>Denham: Table edited by Denham via TableEdit</p> <hr /> <div>&lt;!--<br /> ***************************************************************************************************************************************************<br /> *<br /> * PLEASE EDIT FROM THE SECTION OR TABLE EDIT LINKS...IF YOU SEE THIS MESSAGE,<br /> * YOU'RE PROBABLY IN THE WRONG PLACE<br /> *<br /> *<br /> ***************************************************************************************************************************************************<br /> --&gt;{{#css:Suppresslinks.css}}&lt;css&gt;{{:Suppresslinks.css}}&lt;/css&gt;<br /> &lt;noinclude&gt;{{TabsTop}} <br /> {{Tab|Quickview|fabF}}{{Tab On|Gene|fabF}}{{Tab|Gene Product(s)|fabF}}{{Tab|Expression|fabF}}{{Tab|Evolution|fabF}}{{Tab|On One Page|fabF}}{{TabsBottom}}<br /> {|<br /> |- style=&quot;background-color:white; border:solid 2px #CCFFFF; text-align:center; white-space: nowrap;&quot; <br /> |{{Sub}}[[#Nomenclature |Nomenclature]]<br /> |{{Sub}}[[#Location(s) and DNA Sequence|Location(s) and DNA Sequence]]<br /> |{{Sub}}[[#Sequence Features|Sequence Features]]<br /> |{{Sub}}[[#Alleles and Phenotypes |Alleles and Phenotypes]]<br /> |{{Sub}}[[#Genetic Interactions | Genetic Interactions]]<br /> |{{Sub}}[[#Genetic Resources |Genetic Resources]]<br /> |{{Sub}}[[#Accessions in Other Databases |Accessions]]<br /> |{{Sub}}[[#Links |Links]]<br /> |{{Sub}}[[#References |References]]<br /> |{{Sub}}[[Talk:{{PAGENAMEE}}| Suggestions]]<br /> |}<br /> &lt;/noinclude&gt;&lt;protect&gt;<br /> ==Nomenclature==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12739.B46a9bf736ca0f--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_nomenclature_help}}<br /> {| id=&quot;B46a9bf736ca0f&quot; class=&quot; tableEdit Gene_nomenclature_table&quot; <br /> <br /> |-<br /> !align=left {{table_heading_style}} |Standard name<br /> ||<br /> ''fabF''<br /> |-<br /> !align=left {{table_heading_style}} |Mnemonic<br /> ||<br /> Fatty acid biosynthesis<br /> |-<br /> !align=left {{table_heading_style}} |Synonyms<br /> ||<br /> ''ECK1081, b1095, JW1081, cvc, fabJ, vtr, vtrB''&lt;ref name='LIB:Riley_2006'/&gt;<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12739.B46a9bf736ca0f&amp;page=12739&amp;pagename={{FULLPAGENAMEE}}&amp;type=1&amp;template=Gene_nomenclature_table edit table]&lt;/span&gt; ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12739.B46a9bf736ca0f--&gt;<br /> <br /> &lt;!--Nomenclature_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Location(s) and DNA Sequence==<br /> {{BacktoTop}}<br /> &lt;protect&gt;<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12739.N46a9bf73e63f2--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_location_help}}<br /> {| id=&quot;N46a9bf73e63f2&quot; class=&quot; tableEdit Gene_location_table&quot; <br /> |- {{table_heading_style}}<br /> !|Strain!!Map location!!Genome coordinates!!Genome browsers!!Sequence links<br /> |- <br /> |<br /> MG1655<br /> |<br /> 24.81 minutes&amp;nbsp;<br /> |<br /> MG1655: 1151162..1152403&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_000913:1151162..1152403<br /> source=MG1655<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> *[http://biocyc.org/ECOLI/NEW-IMAGE?type=LOCUS-POSITION&amp;chromosome=COLI-K12&amp;object=EG12606 EcoCyc]<br /> {{GBrowseLink|MG1655|NC_000913|1150162|1153403|GBrowse(MG1655)}}<br /> <br /> |<br /> {{GBrowseFastaLink|MG1655|NC_000913|1151162|1152403|FASTA Dump}}<br /> *[http://biocyc.org/ECOLI/sequence?object=EG12606 EcoCyc Sequence Dump] <br /> |- <br /> |<br /> [[REL606]]<br /> |<br /> <br /> |<br /> NC_012967: 1166508..1167749&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012967:1166508..1167749<br /> source=REL606<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|REL606|NC_012967|1166508|1167749|GBrowse (REL606)}}<br /> |<br /> {{GBrowseFastaLink|REL606|NC_012967|1166508|1167749|FASTA Dump}} <br /> |- <br /> |<br /> [[BW2952]]<br /> |<br /> <br /> |<br /> NC_012759: 1055087..1056328&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_012759:1055087..1056328<br /> source=BW2952<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|BW2952|NC_012759|1055087|1056328|GBrowse (BW2952)}}<br /> |<br /> {{GBrowseFastaLink|BW2952|NC_012759|1055087|1056328|FASTA Dump}} <br /> |- <br /> |<br /> W3110<br /> |<br /> &amp;nbsp;<br /> |<br /> W3110: 1153516..1154757&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=AC_000091:1153516..1154757<br /> source=W3110<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|W3110|AC_000091|1152516|1155757|GBrowse(W3110)}} <br /> |<br /> {{GBrowseFastaLink|W3110|AC_000091|1153516|1154757|FASTA Dump}} <br /> |- <br /> |<br /> [[DH10B]]<br /> |<br /> <br /> |<br /> DH10B: 1206607..1207848&lt;br /&gt;&lt;gbrowseImage&gt;<br /> name=NC_010473:1206607..1207848<br /> source=DH10B<br /> preset=GeneLocation<br /> &lt;/gbrowseImage&gt;<br /> <br /> |<br /> {{GBrowseLink|DH10B|NC_010473|1204125|1210330|GBrowse(DH10B)}}<br /> |<br /> {{GBrowseFastaLink|DH10B|NC_010473|1204125|1210330|FASTA Dump}} <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12739.N46a9bf73e63f2&amp;page=12739&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_location_table edit table]&lt;/span&gt; || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12739.N46a9bf73e63f2--&gt;<br /> <br /> &lt;!--Location_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Sequence Features==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12739.Z46a9bf7491cbc--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_sequence_features_help}}<br /> {| id=&quot;Z46a9bf7491cbc&quot; class=&quot; tableEdit Gene_sequence_features_table&quot; <br /> |- {{table_heading_style}}<br /> !|Feature Type!!Strain!!Genomic Location!!Evidence!!Reference!!Notes<br /> |- <br /> |<br /> Coding Start (SO:0000323)<br /> |<br /> [[MG1655]]<br /> |<br /> 1151165<br /> |<br /> Edman degradation<br /> |<br /> PMID:7972002&lt;br /&gt;<br /> |<br /> <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12739.Z46a9bf7491cbc&amp;page=12739&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_sequence_features_table edit table]&lt;/span&gt; || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12739.Z46a9bf7491cbc--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Sequence_notes--&gt;&lt;/protect&gt;<br /> ====Notes====<br /> <br /> <br /> ==Alleles and Phenotypes==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12739.R46a9bf74d2ee3--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_alleles_help}}<br /> {| {{Prettytable}} id=&quot;R46a9bf74d2ee3&quot; class=&quot; tableEdit Gene_allele_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Allele!!Nt change(s)!!AA change(s)!!Phenotype: Type!!Phenotype: Description!!Reference!!Availability!!Comments<br /> |- <br /> |<br /> &amp;Delta;fabF (Keio:JW1081)<br /> |<br /> deletion<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/keioCollectionQueryAction.do Shigen]&lt;br&gt;[http://cgsc2.biology.yale.edu/Strain.php?ID=107310 CGSC9029]&lt;ref name='LIB:cgsc'/&gt; <br /> |<br /> <br /> |- <br /> |<br /> [http://asap.ahabs.wisc.edu/asap/feature_info.php?FeatureID=ABE-0003705 fabF::Tn5KAN-2] (FB20101)<br /> |<br /> Insertion at nt 908 in Plus orientation<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:15262929<br /> |<br /> [http://www.genome.wisc.edu/resources/forms/strainrequest.htm E. coli Genome Project:FB20101]<br /> |<br /> does not contain [[pKD46]] <br /> |- <br /> |<br /> ''fabF200''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:7259|CGSC:7259]]<br /> |<br /> <br /> |- <br /> |<br /> ''fabF202''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> [[cgscmutation:8804|CGSC:8804]]<br /> |<br /> <br /> |- <br /> |<br /> ''&amp;#916;fabF759::kan''<br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> <br /> |<br /> PMID:16738554<br /> |<br /> [[cgscmutation:100774|CGSC:100774]]<br /> |<br /> <br /> |- <br /> |<br /> fabF<br /> |<br /> deletion<br /> |<br /> <br /> |<br /> Sensitivity to<br /> |<br /> increases sensitivity to bicyclomycin<br /> |<br /> PMID:21357484<br /> |<br /> <br /> |<br /> fig 2 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12739.R46a9bf74d2ee3&amp;page=12739&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_allele_table edit table]&lt;/span&gt; || || || || || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12739.R46a9bf74d2ee3--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Alleles_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> <br /> ==Genetic Interactions==<br /> {{BacktoTop}}<br /> &lt;protect&gt;&lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.12739.Y4e04baa4840a5--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Genetic_interaction_help}}<br /> {| id=&quot;Y4e04baa4840a5&quot; class=&quot; tableEdit Genetic_interaction_table dataTable&quot; <br /> |- {{table_heading_style}}<br /> !|Interactor!!Interaction!!Allele!!Score(s)!!Reference(s)!!Accessions!!Notes<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=bc145ea147f7e36caf09c1bfeed4ee9d.12739.Y4e04baa4840a5&amp;page=12739&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Genetic_interaction_table edit table]&lt;/span&gt; || || || || || ||<br /> |}<br /> &lt;!--box uid=bc145ea147f7e36caf09c1bfeed4ee9d.12739.Y4e04baa4840a5--&gt;&lt;/protect&gt;<br /> <br /> &lt;!-- Genetic Interacdtions Notes --&gt;<br /> ===Notes===<br /> <br /> ==Genetic Resources==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12739.V46a9bf757ed04--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_resources_help}}<br /> {| id=&quot;V46a9bf757ed04&quot; class=&quot; tableEdit Gene_resource_table&quot; <br /> |- {{table_heading_style}}<br /> !|Resource!!Resource Type!!Source!!Notes/Reference<br /> |- <br /> |<br /> JW1081<br /> |<br /> Plasmid clone<br /> |<br /> [http://www.shigen.nig.ac.jp/ecoli/strain/askaCloneQueryAction.do?strainTypeId=9 Shigen]<br /> |<br /> PMID:16769691<br /> <br /> Status:Clone OK<br /> <br /> Primer 1:GCCTCTAAGCGTCGTGTAGTTGT<br /> <br /> Primer 2:CCGATCTTTTTAAAGATCAAAGA <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:14C1|14C1]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=235 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[:Category:Kohara_Phage:E9G1|E9G1]]<br /> |<br /> Kohara Phage<br /> |<br /> [http://ecoli.aist-nara.ac.jp/GB6/kohara_info.jsp?fword=236 Genobase]<br /> |<br /> PMID:3038334 <br /> |- <br /> |<br /> [[yccE:Gene|zcc-282::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG18466 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39414 CGSC7359]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: % &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> |- <br /> |<br /> [[yceG:Gene|zce-726::Tn10]]<br /> |<br /> Linked marker<br /> |<br /> CAG12078 = [http://cgsc2.biology.yale.edu/Strain.php?ID=39418 CGSC7361]&lt;ref name='LIB:cgsc'/&gt;<br /> |<br /> est. P1 cotransduction: 87% &lt;ref name='LIB:Nichols_linked_Tn'/&gt; <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12739.V46a9bf757ed04&amp;page=12739&amp;pagename={{FULLPAGENAMEE}}&amp;type=&amp;template=Gene_resource_table edit table]&lt;/span&gt; || || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12739.V46a9bf757ed04--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_resources_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Accessions in Other Databases==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12739.X46a9bf7616097--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;{{Gene_accessions_help}}<br /> {| id=&quot;X46a9bf7616097&quot; class=&quot; tableEdit Gene_accessions_table&quot; <br /> |- {{table_heading_style}}<br /> !|Database!!Accession!!Notes<br /> |- <br /> |<br /> [http://ecocyc.org EcoCyc] ([[EcoCyc|EcoliWiki Page]])<br /> |<br /> [http://biocyc.org/ECOLI/NEW-IMAGE?type=NIL&amp;object=EG12606 ECOCYC:EG12606]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://ecogene.org EcoGene] ([[EcoGene|EcoliWiki Page]])<br /> |<br /> [http://ecogene.org/geneinfo.php?eg_id=EG12606 EcoGene:EG12606]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> |- <br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene NCBI] ([[NCBI|EcoliWiki Page]])<br /> |<br /> [http://www.ncbi.nlm.nih.gov/gene?term=946665 GeneID:946665]<br /> |<br /> Escherichia coli str. K-12 substr. MG1655 <br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12739.X46a9bf7616097&amp;page=12739&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Gene_accessions_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12739.X46a9bf7616097--&gt;<br /> <br /> &lt;protect&gt;&lt;!--Gene_accessions_notes--&gt;&lt;/protect&gt;<br /> ===Notes===<br /> <br /> <br /> ==Links==<br /> {{BacktoTop}}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12739.T46a6dce618bb5--&gt;<br /> &lt;!--<br /> ******************************************************************************************<br /> * <br /> * ** PLEASE DON'T EDIT THIS TABLE DIRECTLY. Use the edit table link under the table. ** <br /> * <br /> ****************************************************************************************** --&gt;<br /> {| id=&quot;T46a6dce618bb5&quot; class=&quot; tableEdit Links_table&quot; <br /> |- {{table_heading_style}}<br /> !|Name!!URL!!Comments<br /> <br /> |- class=&quot;tableEdit_footer&quot; <br /> |&lt;span class=&quot;tableEdit_editLink plainlinks&quot;&gt;[{{SERVER}}{{SCRIPTPATH}}?title=Special:TableEdit&amp;id=421aa90e079fa326b6494f812ad13e79.12739.T46a6dce618bb5&amp;page=12739&amp;pagename={{FULLPAGENAMEE}}&amp;type=0&amp;template=Links_table edit table]&lt;/span&gt; || ||<br /> |}<br /> &lt;!--box uid=421aa90e079fa326b6494f812ad13e79.12739.T46a6dce618bb5--&gt;<br /> <br /> <br /> &lt;noinclude&gt;&lt;protect&gt;<br /> ==References==<br /> {{BacktoTop}}<br /> {{RefHelp}}<br /> &lt;references /&gt;<br /> __NOTOC__<br /> ===Categories===<br /> [[Category:Gene List:MG1655]]<br /> [[Category:Gene List:W3110]]<br /> [[Category:Genes in the Keio knockout collection]]<br /> [[Category:Genes in the ASKA clone collection]]<br /> [[Category:fab genes]][[Category:Gene_List:DH10B]][[Category:Gene_List:REL606]]<br /> [[Category:Gene_List:BW2952]]</div> Denham