TableEdit

Jump to: navigation, search

argH:Gene

You don't have sufficient rights on this wiki to edit tables. Perhaps you need to log in. Changes you make in the Table editor will not be saved back to the wiki

See Help for Help on this wiki. See the documentation for how to use the table editor

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

public

JW3932

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCGCACTTTGGGGCGGGCGTTT

Primer 2:CCgCCTAACCGAGCCTGCGCAAA

public

4G11

Kohara Phage

Genobase

PMID:3038334

public

8H10

Kohara Phage

Genobase

PMID:3038334

public

argE86::Tn10

Linked marker

CAG12185 = CGSC7471[1]

est. P1 cotransduction: 93% [2]

public

thiC39::Tn10

Linked marker

CAG18500 = CGSC7472[1]

est. P1 cotransduction: 19% [2]
Synonyms:thi-39::Tn10

  1. 1.0 1.1 CGSC: The Coli Genetics Stock Center
  2. 2.0 2.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).



Cancel