TableEdit

Jump to: navigation, search

atpG:On One Page

You don't have sufficient rights on this wiki to edit tables. Perhaps you need to log in. Changes you make in the Table editor will not be saved back to the wiki

See Help for Help on this wiki. See the documentation for how to use the table editor

See Help:Gene_resources for help entering information into the Genetic Resources table.

This table comes from a different page; cancelling or saving changes will send you to the original source page. Use the back button on your browser to return to the page you were viewing
Resource Resource Type Source Notes/Reference

public

JW3711

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCGCCGGCGCAAAAGAGATACG

Primer 2:CCAACCGCGGCGGCCCCCGAGAC

public

2A1

Kohara Phage

Genobase

PMID:3038334

public

zid-501::Tn10

Linked marker

CAG18499 = CGSC7458[1]

est. P1 cotransduction: 17% [2]

public

rbsD296::Tn10

Linked marker

CAG18501 = CGSC7460[1]

est. P1 cotransduction: 60% [2]
Synonyms:zie-296::Tn10

  1. 1.0 1.1 CGSC: The Coli Genetics Stock Center
  2. 2.0 2.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).



Cancel