TableEdit

Jump to: navigation, search

nadA:Gene

You don't have sufficient rights on this wiki to edit tables. Perhaps you need to log in. Changes you make in the Table editor will not be saved back to the wiki

See Help for Help on this wiki. See the documentation for how to use the table editor

See Help:Gene_resources for help entering information into the Genetic Resources table.

Resource Resource Type Source Notes/Reference

public

JW0733

Plasmid clone

Shigen

PMID:16769691

Status:Clone OK

Primer 1:GCCAGCGTAATGTTTGATCCAGA

Primer 2:CCTCCACGTAGTGTAGCCGCAAA

public

10G5

Kohara Phage

Genobase

PMID:3038334

public

4H1

Kohara Phage

Genobase

PMID:3038334

public

asnB3057::Tn10

Linked marker

CAG18433 = CGSC7349[1]

est. P1 cotransduction: % [2]
Synonyms:zbf-3057::Tn10 nnnThe Tn10 in CAG18433 is inserted in the asnB regulatory region, 4 bp before the start of the asnB ORF.

public

zbh-29::Tn10

Linked marker

CAG18493 = CGSC7353[1]

est. P1 cotransduction: 19% [2]
Synonyms:zbi-29::Tn10

  1. 1.0 1.1 CGSC: The Coli Genetics Stock Center
  2. 2.0 2.1 The Tn10 insertion sites determined by Nichols et al. 1998 (PMID:9829956) were reannotated by alignment with E. coli K-12 genome sequence (GenBank accession NC_000913). P1 contransduction frequencies were calculated using the formula of Wu (PMID:5338813).



Cancel